Journal of Biotechnology 122(2006)
473–482
Establishment of an experimental system allowing immobilization
of proteins on the surface of Bacillus subtilis cells
Hoang Duc Nguyen,Wolfgang Schumann ∗
Institute of Genetics,University of Bayreuth,D-95440Bayreuth,Germany
Received 23May 2005;received in revid form 30August 2005;accepted 21September 2005
Abstract
Gram-positive bacteria code for one or more enzymes termed sortas which catalyze the covalent anchoring of substrate proteins on their cell wall.They recognize an amino acid quence designated sorting motif,prent clo to the C-terminal end of the substrate proteins,cleave within this motif and catalyze anchoring of the polypeptide chain to the peptide crossbridge linking the peptidoglycan strands in a transpeptidation reaction.Bacillus subtilis has been reported to code for two different sortas but the sorting quences recognized by them are yet unknown.To be able to immobilize proteins on the surface of B.subtilis cells,we introduced the srtA gene coding for sorta A of Listeria monocytogenes with the known sorting motif (LPXTG)into B.subtilis .L.monocytogenes and B.subtilis share the same peptide crossbridge.Next,we fud the coding region of an ␣-amyla gene to the C-terminal region of Staphylococcus aureus fibronectin binding protein B containing the sorting motif.Covalent linkage could be proven by treatment of the cells with lysozyme and by immunofluorescence microscopy.Up to 240,000molecules of ␣-amyla could be immobilized per cell,24times more than previously reported for other bacterial species.To study the influence of the distance between the sorting motif and the C-terminus of ␣-amyla on the activity of the enzyme,the length of the spacer was varied.It turned out that the highest activity was measured with a spacer length of 123amino acid residues.
©2005Published by Elvier B.V .
Keywords:Sorta;Cellular chips;Listeria monocytogenes ;Fibronectin binding protein B
1.Introduction
Surface proteins of eubacteria play an important role in pathogenicity.While in Gram-negative bacte-ria,the proteins are predominantly anchored in the
∗
Corresponding author.Tel.:+49921552708;fax:+49921552710.
E-mail address:wschumann@uni-bayreuth.de (W.Schumann).outer membrane (Lee et al.,2003),Gram-positive bac-teria utilize their cell wall for anchoring and display of surface proteins (Navarre and Schneewind,1999).One important mechanism of protein anchoring utilizes sorta,a transpeptida that cleaves substrate proteins at a conrved quence,the sorting motif (for recent reviews,e Paterson and Mitchell,2004;Ton-That et al.,2004).Screening of quenced genomes of Gram-positive bacteria revealed that typically more than one
0168-1656/$–e front matter ©2005Published by Elvier B.V .doi:10.1016/j.jbiotec.2005.09.012
474H.D.Nguyen,W.Schumann/Journal of Biotechnology122(2006)473–482
高中出国留学需要什么条件>读书感言
sorta homologue is prent(Pallen et al.,2001).The Staphylococcus aureus genome codes for two sortas, sorta A and B,encoded by srtA and srtB(Mazmanian et al.,1999,2002;Pallen et al.,2001).While sorta A recognizes the sorting quence LPXTG and cleaves the peptide bond between the threonine and glycine residues(Ton-That et al.,1999),sorta B recognizes the NPQTN motif catalyzing cleavage of the peptide bond between T and N(Zong et al.,2004).
ykw
Sortas have also been ud to anchor foreign pro-teins on the cell wall of different Gram-positive bac-teria.Thefirst heterologous protein to be immobilized was the alkaline phosphata li(Schneewind et al.,1992).When the coding region of this enzyme was sandwiched between that of the signal quence and the sorting quence of protein A,the hybrid protein was found equally in the medium and the cell wall. In the same year,it was reported that another hybrid protein consisting of the E7protein of human papil-lomavirus type16and the M6surface protein from Streptococcus pyogenes could be anchored on the sur-face dinii(Pozzi et al.,1992).During the following years,the surface-display methods have been widely exploited for vaccine delivery,develop-ment of biocatalysts and metal binding surface protein (reviewed in Wern´e rus et al.,2002).
We are interested to develop B.subtilis cells into cellular chips.B.subtilis offers veral advantages o
ver other Gram-positive bacteria:(i)it is considered as a GRAS organism(generally regarded as safe); (ii)it has a naturally high cretion capacity;(iii) the genetics including transcription,translation,and cretion mechanisms and genetic manipulation are far advanced;(iv)large-scale fermentation techniques have been developed(Westers et al.,2004;Meima et al., 2004).Though two putative sortas have been identi-fied in B.subtilis(yhcS and ywpE)(Pallen et al.,2001) neither substrates nor the sorting motifs recognized by the sortas have been reported.Therefore,we intro-duced the srtA gene of Listeria monocytogenes into B. subtilis which recognizes the LPXTG motif(Dhar et al.,2000).Furthermore,this sorta recognizes a pep-tidoglycan crossbridge that is identical to that prent in the cell wall of B.subtilis(Navarre and Schneewind, 1999).To anchor the normally creted B.amyloliq-uefaciens␣-amyla on the cell surface of B.sub-tilis,its C-terminus was fud to the C-terminal region of S.aureusfibronectin binding protein B(FnBPB)(J¨o nsson et al.,1991).Here,we show that up to240,000 molecules of enzymatically active␣-amyla can be anchored on the cell wall of B.subtilis.
2.Materials and methods
2.1.Bacterial strains,plasmids and growth conditions
The bacterial strains and plasmids ud are listed in li strain DH10B(Stratagene)was ud as recipient in cloning experiments.Cells were rou-tinely grown aerobically in Luria-Bertani(LB)broth at 37◦C,and antibiotics were added were as appropriate (ampicillin at50g/ml;chloramphenicol at10g/ml; erythromycin at1or100g/ml).
2.2.Construction of recombinant plasmids and strains
To allow controlable expression of the sorta A gene(srtA)togenes(Ripio et al.,1996) Table1
Bacterial strains and plasmids ud
B.subtilis
WW02leuA8metB5trpC2hsdRM1
amyE::neo
Wehrl et al.,
2000
日久见人心的英文
NHD03WW02with srtA gene
integrated at lacA
This work
Plasmids
pAL01Carries an IPTG-inducible
客服专员英文expression castte
Sch¨o bel et al.,
2004 pHCMC04Carries a xylo-inducible
expression castte
Nguyen et al.,
2005
pKTH10pUB110with amyQ Palva,1982 pNDH09pAL01with srtA of L.
monocytogenes
This work
pNDH10pHCMC04with FnBPB94This work pNDH15pHCMC04carrying amyQ This work pNHD16amyQ translationally fud to
FnBPB94in pNDH10
This work pNHD19FnBPB123translationally
fud to amyQ in pNDH16
This work
pNHD20FnBPB162translationally
fud to amyQ in pNDH16
This work
pNHD21FnBPB196translationally
fud to amyQ in pNDH16
This work pNHD22FnBPB234translationally
fud to amyQ in pNDH16
This work
H.D.Nguyen,W.Schumann/Journal of Biotechnology122(2006)473–482475 Table2
学汽车美容Oligonucleotides ud
ON15 end of srtA togenes
GGCCATGGATCCATGTTAAAGAAAAACAATTGCAATAATAATT
ON23 end of srtA togenes
GGCCATGCATGCTCATTATTTACTAGGGAAATATTTATTCTC
ON35 end of fnbB94of S.aureus
GGCCATGACGTCGGAGGTACCCCAACGCCACCGACACCAGAAG
blocON55 end of fnbB123of S.aureus
GGCCATGACGTCCCGCGGAGTGGTCATAATGAAGGTCAACAAAC
ON65 end of fnbB162of S.aureus
英文商务邀请函范文GGCCATGACGTCCCGCGGCACGGATTCAATAAGCACACTGA
ON75 end of fnbB196of S.aureus
GGCCATGACGTCCCGCGGAATGGTAACCAATCATTCGAAGAAG
ON85 end of fnbB234of S.aureus
GGCCATGACGTCCCGCGGAGCGGTAATCAGTCATTTGAGG
ON93 end of fnbB of S.aureus
eox>when you are gone 歌词
GGCCATCCCGGGTTATGCTTTGTGATTCTTTTTATTTCTGCG
ON105 end of amyQ of B.amyloliquefasciens
GGCCATGGATCCATGATTCAAAAACGAAAGCGGACAG
ON115 end of amyQ of B.amyloliquefasciens
GGCCATGACGTCTTTCTGAACATAAATGGAGACGGAC
Restriction sites are underlined.
in B.subtilis,its coding quence was amplified using oligonucleotides(ON)1and2(e Table2)and chro-mosomal DNA togenes strain P14(Ripio et al.,1996)as template.The amplicon was cleaved with Bam HI and Sph I and inrted into plasmid pAL01 treated with the same enzymes resulting in pNDH09;in this plasmid,srtA is fud to the IPTG-inducible pro-moter P spac.Next,pNDH09was transformed into B. subtilis strain WW02(this strain was chon becau it carries a null mutation in its␣-amyla gene amyE), recombinants were lected on LB plates containing erythromycin.Correct integration at the lacA locus (H¨a rtl et al.,2001)was confirmed by PCR,and one transformant(NHD03)was kept for further studies.
To allow covalent anchoring of the coding region of the␣-amyla gene amyQ of B.amyloliquefaciens and any other gene on the B.subtilis cell wall,a sort-ing vector was constructed.This sorting vector con-tains part of the coding region of thefibronectin bind-ing protein B gene(fnbB)of Staphylococcus aureus (J¨o nsson et al.,1991)inrted into the expression vec-tor pHCMC04(Nguyen et al.,2005).This expres-sion vector contains a xylo castte consisting of the xylR repressor and the promoter/operator region of the xylAB operon(Kim et al.,1996)which can be induced by the addition of xylo.The coding region of the3 end offibronectin B(consisting of the immedi-ate3 end including the sorting motif and additional 94codons,the spacer region)was amplified using ON3and ON9,the amplicon was cleaved with Aat II and Sma I and inrted into pHCMC04treated with the same enzymes resulting in pNHD10.Next,the amyQ gene was generated by PCR using pKTH10and ON10and ON11,the amplicon treated with Bam HI and Aat II and ligated into pNHD10cut with the same enzymes resulting in pNDH16.In addition,amyQ was inrted into pHCMC04(pNHD15).Furthermore, the spacer length was varied from94amino acids (FnBPB94)to234(FnBPB234).To obtain this goal, oligos ON5through ON8were ud together with ON9to amplify the appropriate regions of fnbB.Then, the amplicons cut by Aat II and Stu I were ud to replace the Aat II/Sma I fragment in pNHD16resulting in the new plasmids pNDH19(FnBPB123),pNDH20 (FnBPB162),pNDH21(FnBPB196)and pNDH22 (FnBPB234).
2.3.Immunofluorescence microscopy
All steps of this procedure were carried out at room temperature.Life cells were washed in PBS(80mM Na2HPO4,20mM NaH2PO4,100mM NaCl,pH7.5) and resuspended in PBS containing the primary anti-body(raid in rabbits against B.amyloliquefaciens
476H.D.Nguyen,W.Schumann/Journal of Biotechnology122(2006)473–482
␣-amyla)at a dilution of1:3000for1h(Strauss and G¨o tz,1996).Then,the cells were washed and incubated with anti-rabbit IgG Alexa conjugate(Alexa Fluor®568goat anti-rabbit IgG;Molecular Probes)at a dilu-tion of1:2000.A3l aliquot of this cell suspension was spread onto a slide,air dried and obrved under a confocal microscope(Leica).
2.4.Lysozyme treatment of whole cells and
α-amyla assay
To relea the␣-amyla anchored on the cell wall,whole cells were treated with lysozyme.Cells were incubated with lysozyme(500g/ml dissolved in water)for30min.After a centrifugation step,the super-natant was assayed for␣-amyla activity as described (Nicholson and Chambliss,1985).In brief,the a
mount of soluble starch remaining after incubation with␣-amyla was stained with I2/KI.
3.Results
3.1.Expression of the sorta A of Listeria monocytogenes in B.subtilis
The srtA gene togenes was fud to the IPTG-inducible P spac promoter and integrated ectopi-cally at the lacA locus resulting in strain NDH03.To demonstrate regulatable expression of the srtA gene, B.subtilis strains WW02(control,no srtA gene)and NHD03werefirst grown in the abnce of IPTG to the mid-logarithmic growth pha and then submitted to IPTG-induction.Aliquots were subjected to SDS-PAGE,blotted and probed with polyclonal antibodies raid against sorta A.When extracts from WW02 were analyzed,two bands became visible most proba-bly unknown proteins of B.subtilis cross-reacting with the antibodies(Fig.1,lanes1and2).When extracts from strain NHD03were probed,a new band of the molar mass of sorta A(estimated molecular mass: 30kDa)became apparent even in the abnce of IPTG which dramatically incread after addition of1mM IPTG(lanes3–7).We conclude from this experiment that strain NHD03is able to produce a low amount of sorta A in the abnce of inducer most probably due to the leakiness of the P spac promoter which can be significantly enhanced after addition of IPTG.
Next,Fig.1.Detection of sorta A togenes in extracts of B.subtilis.B.subtilis strains WW02and NHD03were grown in LB medium to the mid-exponential growth pha at37◦C.Then, the cultures were split in two subcultures(t=0),where one was further grown untreated while the cond was induced with1mM IPTG.Aliquots were taken at t=0,30,and60min and procesd for immunoblotting.Strain WW02uninduced(lane1)and IPTG-induced for60min(lane2);strain NDH03uninduced at t=0(lane 3),t=30(lane4)and t=60(lane5);strain NDH03induced with IPTG at t=30(lane6)and t=60(lane7).M,molecular weight markers as indicated.
we analyzed whether the sorta is able to anchor␣-
amyla covalently on the cell wall of B.subtilis.
3.2.Theα-amyla—FnBPB fusion protein can be anchored on the cell wall
First,an anchoring vector was constructed by inrt-
ing the coding region of the3 terminal part of the
fnbB gene(FnBPB94)of S.aureus coding forfibronec-tion binding protein B(J¨o nsson et al.,1991)includ-
ing the sorting motif followed by another94codons
called the spacer region(in total131amino acids)
into pHCMC04carrying a xylo-inducible expression
castte(Nguyen et al.,2005)resulting in pNHD10.
Next,the amyQ gene of B.amyloliquefaciens(Palva,
1982)coding for␣-amyla was translationally fud
to FnBPB94(pNHD16).We have chon an␣-amyla
as a model protein since this protein is naturally
creted and its enzymatic activity can be easily mea-
sured.Plasmids pNDH15(devoid of the sorting motif)
and pNHD16were transformed into B.subtilis strains
WW02and NHD03.Cells of the strains were grown
in the abnce or prence of sorta A or/and hybrid ␣-amyla.Next,whole cells were parated from the growth medium by centrifugation,and both cells and
supernatants were analyzed parately for␣-amyla
activity.
While a background level in the abnce of any ␣-amyla of2–6units were measured,this activity incread significantly in the supernatant in the pres-ence of amyQ(134units;Table3).Expression of the hybrid␣-amyla in the abnce of sorta A reduced its activity to98units indicating impairement by the
H.D.Nguyen,W.Schumann/Journal of Biotechnology122(2006)473–482477 Table3
␣-Amyla activities measured with different strains
Cells␣-amyla gene prent Sorting quence prent Sorta prent Units
Strain Plasmid Supernatant Cells
NDH03pHCMC04−−+ 6.1±1.9 1.9±0.5 NDH03pNDH15+−+133.7±22.4 4.3±2.2 WW02pNDH16++−98.0±12.1 5.2±1.9 NDH03pNDH16+++93.7±11.311.0±2.5 NDH03pNDH19+++124.1±21.623.3±4.6
Cells were grown to an OD578of0.1at37◦C.Then,1mM IPTG was added to induce production of sorta A into allfive cultures.When the cultures reached an OD578of0.8,0.5%xylo was added to induce production of wild-type(pNDH15)and hybrid␣-amyla(from pNDH16 and pNDH19).Allfive cultures were further grown for2h.Then,aliquots were collected,the cells were parated from the growth medium by centrifugation and␣-amyla activities were determined with whole cells and with the supernatants and prented in units per OD578.
C-terminal extension of94amino acid residues.When both sorta A and the hybrid␣-amyla were synthe-sized,there was a increa in the enzymatic activity to 11units with a spacer length of94amino acids which doubled with a spacer length of123(Table3)measured with whole cells.In the latter ca,15.8%of the total ␣-amyla activity was associated with the cells.
Next,we wanted to show directly that the␣-amyla is indeed anchored on the cell wall.To accomplish this goal,cells of strains WW02and NDH03carry-ing pNDH15and pNDH16,respectively,were grown as described before.Aliquots of supernatants or cells treated with lysozyme were prepared for immunoblot-ting,and the results are prented in Fig.2.While strain NDH03carrying pNDH15produced only authentic␣-amyla(molecular mass:50kDa)as to be expected (lane1),hybrid␣-amyla(69kDa)could be recov-ered from supernatants of strains WW02and NDH03 (lanes2and3).When cells of strain WW02carrying pNDH16were treated with lysozyme,no␣-amyla could be relead(lane4)in contrast to strain NDH03 expressing sorta A(lane5).This result unequivo-cally demonstrates that sorta A togenes expresd in a heterologous host can covalently anchor ␣-amyla on the cell wall of B.subtilis.
3.3.Immunofluorescence detection ofα-amyla
In an independent experiment,we aimed to directly demonstrate that␣-amyla is covalently
bound Fig.2.Detection of␣-amyla by immunoblotting.Strains WW02and NDH03harbouring pNDH15or pNDH16grown in LB medium and equal amounts of cells were treated as described in the legend to Table3.After paration by centrifugation,the␣-amyla prent in the supernatants was
detected by immunoblotting.Supernatants from strain NDH03/pNDH15(lane1),WW02/pNDH16(lane2),and NDH03/pNDH16(lane 3).Cells from strain WW02and NDH03carrying pNDH16were treatment with lysozyme to relea anchored␣-amyla(CW,lane4).
