Short communication
Highly efficient protein expression and purification
using bacterial hemoglobin fusion vector
Soo-Young Kwon a ,Yoon-Joo Choi a ,Tae-Hong Kang b ,Kwang-Hoon Lee b ,Sun-Shin Cha a ,Gyung-Hwa Kim a ,Heung-Soo Lee a ,Kyong-Tai Kim b ,
Kyung-Jin Kim a,*
a
X-ray Rearch Group,Pohang Accelerator Laboratory,Pohang,Kyungbuk 790-784,Republic of Korea
b
Department of Life Sciences,Pohang University of Science and Technology,Pohang,Kyungbuk 790-784,Republic of Korea
Received 14September 2004,revid 29October 2004
Available online 20January 2005Communicated by Saleem Khan
Abstract
Recently developed bacterial hemoglobin (VHb)fusion expression vector has been widely ud for the production of many target proteins due to its distinctive properties of expressing fusion protein with red color which facilitates visu-alization of the steps in purification,and increasing solubility of the target proteins.However,after intensive u of the vector,veral defects have been found.In this report,we prent a modified VHb fusion vector (pPosKJ)with higher efficiency,in which most of the defects were eliminated.First,it was found that thrombin protea often digests target protein as well as inrted thrombin cleavage site,so it was replaced by a TEV cleavage site for more specific cleavage of VHb from target protein.Second,a glycine-rich linker quence was inrted between 6·his-tag and VHb to improve the affinity of 6·his-tag to Ni–NTA resin,resulting in higher purity of eluted fusion protein.Third,Eco RI and Xho I restriction sites located elwhere in the vector were removed to make the restriction sites available for the cloning of target protein coding genes.A pPosKJ vector was fully examined with an anti-apoptotic BCL-2family member of Cae-norhabditis elegans ,CED-9.A C-terminal VHb fusion expression vector (pPosKJC)was also constructed for stable expression of target proteins that may be difficult to express with an N-terminal fusion.Vaccini
a-related kina 1(VRK1)was also successfully expresd and purified using the vector with high yield.Taken together,we suggest that the VHb fusion vector may be well suited for high-throughput protein expression and purification.Ó2004Elvier Inc.All rights rerved.
Keywords:Vitreoscilla ;Bacterial hemoglobin;Fusion expression vector;CED-9;Vaccinia-related kina 1
0147-619X/$-e front matter Ó2004Elvier Inc.All rights rerved.doi:10.1016/j.plasmid.2004.11.006
*
Corresponding author.Fax:+82542791599.E-mail address:kkj@postech.ac.kr (K.-J.
Kim).
姨妈一个月来两次是怎么回事Plasmid 53(2005)
274–282
/locate/yplas
1.Introduction
Several fusion protein expression vectors have been developed for the expression of recombinant proteins in Escherichia coli.It has been known that fusion expression vectors enhance the productiv-ity,solubility,and uniformity of the target pro-teins compared with nonfusion proteins,and bacterial N-terminus often stabilize eukaryotic proteins in a bacterial ce ll(Bachmair et al., 1986;Putkey et al.,1985;Straus and Gilbert, 1985).For example,malto-binding protein and glutathione S-transfera-binding protein fusion expression vectors are designed to produce fusion proteins that can be purified from cell lysates by substrate-affinity chromatography(di Guan et al.,1988;Guan and
Dixon,1991;Maina et al., 1988;Smith and Johnson,1988).Other vectors are designed to produce target proteins fud with a his-tag which can be ud for the purification by metal-affinity chromatography(Bujard et al., 1987;Studier et al.,1990).
Recently,a bacterial hemoglobin fusion expres-sion vector(pKW32)has been developed to pro-duce fusion proteins with red color which facilitates visualization of the steps in purification (Park et al.,2003).The vector was designed to pro-duce target proteins fud with VHb(Vitreoscilla hemoglobin coded by vgb)which is highly desir-able as a fusion polypeptide becau of high pro-ductivity and solubility of the protein in Escherichia coli cell,and its red color.Moreover, the expression of VHb in heterologous bacteria or yeast enhances cell growth rate and yields of re-combinant proteins under oxygen limiting condi-tions,becau VHb functions as an oxygen carrier to the terminal oxidas(Dikshit et al., 1992;Park et al.,2002;Ramandeep et al.,2001; Tsai et al.,1995a,b).This physiological property of VHb enables the fusion expression vector to produce larger amount of fusion protein with higher solubility.In fact,veral target proteins that were previously difficult to express in soluble form li,were successfully expresd and purified using the vector,and the target proteins include HIV integra(Park et al.,2003),veral microorganismsÕsoluble domain of cyoA and cybd,mou BCL-W,mou DREAM,Drosop-hilla melanogaster GUS,Caenorhabditis elegans CED-9,and so on.
However,after intensive u of the vector,v-eral defects have been found.Some of the target proteins showed internal cleavage with thrombin due to its low specificity,and expresd VHb fu-sion proteins tend to have lower affinity to Ni–NTA resin than his-tagged proteins.In this paper, we report the construction of pPosKJ vector, which is modified from the pKW32by eliminating most of the defects of the vector.We also report the construction of a C-terminal VHb fusion expression vector for the stable expression of the proteins which were difficult to be expresd with N-terminal fusion tag.
2.Materials and methods
2.1.Bacterial strains and materials
Escherichia coli strain DH5a and BL21(DE3) were ud for the cloning and expression of recom-binant genes,respectively.The pKW32and pPosKJ vectors ud in this study contain T5/lacO promoter which can be recognized by li RNAP(Bujard et al.,1987)and lacI gene is lo-cated inside of the vectors.Restriction enzymes, pfu DNA polymera,HiTrap ion exchange col-umns,Ni–NTA chromatographic resin,and TEV protea were purchad from New England Bio-labs,Bioneer(South Korea),Amersham Biosci-ences,Qiagen,and Invitrogen,respectively. Plasmid pre
paration,enzymatic manipulation of DNA,site-directed mutagenesis,bacterial trans-formation,and PCR amplification were performed according to standard protocols.
2.2.Modifications of bacterial hemoglobin fusion vector
Replacement of thrombin cleavage site with TEV cleavage site was performed by PCR amplification. PCR fragment coding for TEV protea cleavage site proceed by VHb and linker coding gene was amplified from pKW32using upstream primer50-CCATCACGGATCCATGTTAGACCAG-30and downstream primer50-GCGCGCATATGGCCTT
Short communication/Plasmid53(2005)274–282275豆腐肉沫
GAAAATACAGGTTTTCGCCACCGCCACCG CCGGAAATGCCAGGATCTGCTTCCACTTG AATAAACACATCTG-30.DNA quences cod-ing for restriction enzymes were underlined.The product was digested with Bam HI and Nde I restric-tion enzymes and cloned into pKW32cleaved with the same restriction enzymes to create pPosKJ (Fig.1).For the inrtion of linker coding quence between 6·his-tag and VHb coding genes,PCR fragment coding for linker-VHb-linker-TEV cleav-age site was amplified from pPosKJ using upstream primer 50-GCGCGGGATCCGGCGGTGGCGG TGGCATTCCTATGTTAGACCAGCAAACCA TTAACATC and d
ownstream primer 50-GCGCG CATATGGCCTTGAAAATACAGGTTTTCGC C-30.The product was digested with Bam HI and Nde I restriction enzymes and cloned into pPosKJ cleaved with same restriction enzymes (Fig.1).Eco RI and Xho I restriction sites,located at the À27and À114from the first methionine coding -quence,respectively,were removed by site-directed mutagenesis,using upstream primer 50-CAATTT CACACAGAGTTCATTAAAGAGGAG-30and downstream primer 50-CTCCTCTTTAATGAA CTCTGTGTGAAATTG-30,and upstream primer 50
落差-CGTCTTCACCTCGACAAATCATAAAAA
Fig.1.Schematic diagrams of pPosKJ and pPosKJC vectors.(A)Cloning and expression region of pPosKJ.The details of the region from the T5promoter to the MCS are shown.An arrow indicates guanine ba mutated from adenine ba to remove Eco RI restriction site (GAATTC).Xho I restriction site (CTCGAG)located À114from the first methionine coding quence was also removed by mutating the last guanine ba to cytosine.The vector is designed to express target protein containing 6·his-tag,linker,VHb,linker,and TEV cleavage site at the N-terminus.(B)Cloning and expression region of pPosKJC.The details of the region from the T7promoter to the 6·his-tag are shown.The vector is designed to express target protein containing TEV cleavage site,linker,VHb,and 6·his-tag at the C-terminus.
276Short communication /Plasmid 53(2005)274–282
ATTTATTTG-30and downstream primer50-CAA ATAAATTTTTTATGATTTGTCGAGGTGAA GACG-30,respectively.
2.3.Construction of C-terminal bacterial hemoglobin fusion vector
蒜蓉辣椒酱
A C-terminal VHb fusion vector was constructed by inrting TEV cleavage site-linker-VHb coding gene into pET21a vectors.DNA fragment coding for TEV cleavage site-linker-VHb was amplified from pPosKJ using upstream primer50-GCGCG AAGCTTGAAAACCTGTATTTTCAAGGCGG AGGAGGATCCATTGGCCCTATGTTAGACC AGCAAACCATTAACATC-30and downstream primer50-GCGCGCTCGAGTCCTCCTCCATC TGCTTCCACTTGAATAAACACATC-30.Ampli-fied DNA fragment was digested with Hin dIII and Xho I restriction enzymes and cloned into pET21a cleaved with same restriction enzymes to create a pPosKJC vector.
2.4.Expression and purification of target proteins
Four p53derivatives were cloned,expresd, and purified as described previously(Lopez-Bor-ges and Lazo,2000).Full-length CED-9coding gene was amplified from Caenorhabditis elegans cDNA library,and cloned into both pKW32and pPosKJ vectors.Full-length Vaccinia-related ki-na1(VRK1)coding gene was cloned into a pPosKJC vector.Expression and purification of CED-9and VRK1were performed by following procedure.An overnight culture of20ml was inoc-ulated into1L of terrific broth medium and the cells were grown at37°C.When the culture reached a log pha(OD600=0.6),the expression of the target genes was induced with1mM isopro-pyl b-D-thiogalactoside.The cells were grown for additional24h at22°C.Harvested cells with red color from ea
ch culture were resuspended in buffer A(20mM Tris–HCl(pH8.0)and5mM b-mercaptoethanol)and lyd by sonication.The supernatant of the cell lysate was loaded on to a Ni–NTA column,which was equilibrated with buffer A.After washing the column by gradually increasing imidazole concentration,proteins were eluted with buffer A containing300mM imidazole.Eluted fraction was loaded onto a HiTrap Q or SP ion exchange column and the bound proteins were eluted by a0–500mM linear NaCl gradient.The(His)6-tagged VHb protein was cleaved by TEV protea with the molar ratio of TEV:protein in1:50and removed by passing the reaction mixture through a Ni–NTA column. Purified target protein was further applied to Hi-Trap Q or SP ion exchange column,when needed.
馒头配方2.5.CD spectroscopy
CD spectra were recorded on a JASCO J-715 spectropolarimeter with protein samples(2.5–10l M)in20mM phosphate buffer(pH7.5)at 25°C over the range of200–250nm in a nitrogen atmosphere.Each spectrum is the accumulation of three scans corrected by subtracting signals from the buffer control.
2.6.In vitro kina assay of VRK-1
Kina activity was measured as described pre-viously(Lopez-Borges and Lazo,2000).Briefly, VRK1and p53derivatives were incubated in 20mM Tris–HCl,pH7.5,containing5mM MgCl2,0.5mM dithiothreitol,150mM KCl,and (10l Ci)[c-32P]ATP for30min at30°C.The reac-tion was stopped by addition of4·reducing buffer, and the products were resolved by SDS–PAGE. The incorporation of[32P]into the proteins was visualized by autoradiography.
3.Results and discussion
3.1.Modifications of bacterial hemoglobin fusion vector
Previously developed bacterial hemoglobin fu-sion expression vector(pKW32)has veral advantages compared with other fusion expression vectors.The expression and purification of the fu-sion protein could be visualized without the need for any further manipulation.Also,the expression of VHb enhances the growth rate of heterologous bacteria li under hypoxic condition. Moreover,VHb-fusion expression increas the
Short communication/Plasmid53(2005)274–282277
solubility of many target proteins that are difficult to express in soluble form using nonfusion or other
fusion expression vectors(Park et al.,2003).How-ever,after intensive u of the vector,it has been revealed that the vector has veral points to be modified for higher efficiency of the vector.First, it has been reported that while thrombin is quite specific for cleavage at the inrted cleavage site, proteolysis can frequently occur at other site(s)in the protein of interest(Jenny et al.,2003).There-fore a thrombin cleavage site(amino acid residues LVPRGS)in pKW32was replaced by a TEV cleavage site(amino acid residues ENLYFQG) to improve the specificity of proteolysis.Second, while6·his-tagged VHb in itlf binds Ni–NTA resin with high affinity,fusion with the target pro-tein can sometimes lower the binding efficiency, resulting in the low purity of the fusion protein after Ni–NTA affinity purification.We assumed that the6·his-tag may interact with certain target proteins,which prevents6·his-tag from binding to the Ni–NTA resin.To parate6·his-tag from VHb-fud target protein,a glycine-rich linker -quence(GGGGGIL)was inrted between the6·his-tag and VHb.Third,Eco RI and Xho I restric-tion sites exist at theÀ27andÀ114from thefirst methionine coding quence,respectively,as well as a multiple cloning site of pKW32vector,which limits the u of the two restriction enzymes for cloning of target protein coding gene.To make the two commonly ud restriction enzyme sites available for cloning,the ones outside the multiple cloning sites were removed by site-directed muta-genesis.The schematic diagram of the modified vector,pPosKJ,is shown in Fig.1A.
坚强的图片
3.2.Expression and purification of CED-9using pPosKJ工行笔试
The utilization of the modified vector was as-sd by expressing VHb-fud CED-9,an anti-apoptotic BCL-2family member of Caenorhabditis elegans(Conradt and Horvitz,1998;del Peso et al.,1998,2000;Woo et al.,2003).Becau expression of CED-9from a pET30a vector as 6·his-tag fusion showed low level of expression and solubility,CED-9coding gene was cloned into pKW32vector using Nde I and Hin dIII restriction sites and the protein was applied to be expresd as VHb fusion,and the result was a tremendous improvement in expression and solubility(Figs. 2A and B).However,when treated with thrombin, purified VHb-fud CED-9showed vere proteol-ysis at the residue16of CED-9as well as inrted cleavage site(Fig.2C).Becau the pH,ionic strength,and temperature can affect the rate and specificity of the thrombin cleavage(Jenny et al., 2003),the cleavage reaction was performed in pH7.0and8.0with various NaCl concentrations of0–300mM at the temperature of4and22°C, resulting in similar internal thrombin cleavage of CED-9protein.Identification of cleaved frag-ments by thrombin was confirmed by Western hybridization using anti-his-tag antibody(data not shown).To prevent internal proteolysis, CED-9coding gene was cloned into pPosKJ vec-tor using Nde I and Hin dIII restriction sites and the resulting plasmid was ud for the expression of CED-9.The resulting VHb-fud CED-9 protein containing a TEV cleavag
自我介绍100e site instead of a thrombin cleavage site was treated with TEV protea,and proteolysis was obrved only at the inrted TEV site,but not at the protein itlf (Fig.2C).
The improvement of binding affinity of fusion protein to Ni–NTA resin by inrtion of a gly-cine-rich liker quence between6·his-tag and VHb was examined by comparing the binding affinity of VHb-fud CED-9expresd from pKW32and that expresd from pPosKJ.VHb-fud CED-9expresd from pKW32was eluted from Ni–NTA resin at imidazole concentration of40mM,resulting in the low purity of fusion protein after Ni–NTA chromatography(Figs.3A and B).However,the fusion protein expresd from pPosKJ was still bound to the resin at the same concentration of imidazole,and was eluted using higher concentration of imidazole,which re-sulted in higher purity of the fusion protein(Figs. 3A and B).We speculate that the improvement of binding affinity of the fusion protein expresd from pPosKJ was due to the spatial paration of6·his-tag from VHb and/or target protein by the glycine-rich linker,and thereby providing more binding opportunities between6·his-tag and the Ni–NTA resin.CED-9was further purified to near
278Short communication/Plasmid53(2005)274–282
