Preparation and Characterization of Monoclonal
Antibody Against Glypican-3
Rui-juan Ma,1Sui-hai Wang,1Shi-ni Qin,1Xiao-bo Wang,1Gao-fei Li,2Ming Li,1
and Wei-wen Xu 1
Glypican-3(GPC3)has been reported as a novel rum and histochemical marker for hepatocellular carcinoma
(HCC)by veral groups.As an oncofetal protein,it is expresd abundantly in the fetal liver,inactive in the normal adult liver,and frequently reactivated in HCC.Immunology reagents are urgently needed to proceed with mechanism-related rearch,clinical validation,and application.In this report,monoclonal antibodies (MAbs)against GPC3were made from hyperimmune BALB/c mice by injecting 100m g of purified antigen intraperitoneally.Hybridomas were screened by indirect enzyme-linked immunosorbent assay (ELISA)using purified protein.Finally 13mou hybridomas producing MAbs to GPC3were established.The MAbs obtained were fully characterized using Western blot analysis,immunofluorescence,and immunohistochemistry.The results showed that the antibodies cou
ld be ud for preliminary application of the next step mechanism-related rearch and GPC3expression level analysis.
Introduction
H
epatocellular carcinoma (HCC)is one of the most common malignant tumors.(1,2)The prognosis of patients with HCC is generally very poor with a 5-year sur-vival rate of <10–15%.This is becau most patients are di-agnod clinically at a late stage,and novel treatment and diagnosis strategies are urgently needed.(3)
GPC3has been reported to be a novel rum and histo-chemical marker for HCC by veral groups.(4–7)GPC3is a member of the heparan sulfate proteoglycan family.The GPC3gene is located on the human X chromosome (Xq26)and encodes a 70kDa core protein with 580amino acids,which can be cleaved by furin to generate a 40kDa amino (N)-terminal protein and a 30kDa membrane-bound car-boxyl(C)-terminal protein.(8)GPC3is linked to the outer surface of the cell membrane through a glycosylphos-phatidylinositol anchor (9)and relead from the cell surface by a lipa called notum to regulate the signaling of Wnts,hedgehogs,fibroblast growth factors (FGFs),and bone morphogenet
ic proteins (BMPs).(10–14)Depending on the cellular context,its function can be stimulatory or inhibitory activity or signaling.GPC3plays an important role in the embryonic and fetal periods of tissue,organ formation,and developmental stages,mainly playing a negative regulatory role,preventing tissue organs from growing too large and regulating body size overall.(15)In tissue GPC3has been
detected in the placenta and fetal liver,but not in other adult organs.During hepatic carcinogenesis,GPC3appears in the HCC tissue and is relead into rum;it was a potential tumor marker for HCC.(4–6)
An effective detection method can provide help for the early diagnosis of HCC.Therefore,a large quantity of monoclonal antibodies (MAbs)specific for GPC3is needed.Several monoclonal and polyclonal antibodies against human GPC3are commercially available from various manufacturers (e.g.,Biomosaics,Burlington,VT;Santa Cruz Biotechnology,Santa Cruz,CA;and R&D Systems,Minneapolis,MN).However,the polyclonal antibody cannot be satisfied for the development of follow-up testing reagents,the monoclonal antibodies available are mainly for the C-terminus of the GPC3(such as 1G12),and also lacking are paired MAbs for the development of follow-up testing reagents.Since the fragment GPC3relea into the blood is the N-terminal,the N-terminal fragment is
the key target for a rum GPC3diagnostic kit.The preparation of anti-GPC3monoclonal antibody against the N-terminal for the development of follow-up testing reagents is necessary.(16–21)
In this study,in order to obtain antibodies for which we would have the independent intellectual property rights and that can be ud to develop rological detection reagents,we have produced,characterized,and purified monoclonal an-tibodies specific for GPC3that can be ud for preliminary and clinical applications.
1School of Biotechnology,Southern Medical University,Guangzhou,P.R.China.
2
First Clinical Medical College,Southern Medical University,Guangzhou,P.R.China.
HYBRIDOMA
Volume 31,Number 6,2012ªMary Ann Liebert,Inc.DOI:10.1089/hyb.2012.0030
455
qq特权Materials and Methods
奥良烤翅
Materials
The PMD18T/GPC3,sp2/0cell line was obtained from the Biotechnology Institute of Southern Medical University Agriculture(Guangzhou,China).BALB/c mice(6–8weeks old,female)were obtained from the Experimental Animal Center of Southern Medical University in China.PHUE plasmid(a gift from Dr.Shu-hong LUO,University of Illinois) was reformed on the vector basis of PET15b,add a period of ubiquitin quence between the His tag and the target protein. Ubiquitin can increa the solubility of the target protein.His and ubiquitin label can be removed from the purified re-combinant protein to harvest,containing only the amino acid quence of the target protein product.
Clone of GPC3gene
As a template to PMD18T/GPC3,according to the -quence in GenBank,the primer quences for amplification of the GPC3gene were as follows:P1,5¢TAATGAATTCATG CAGCCCCCGCCGCC3¢with the EcoRI(GAATTC)restric-tion site;and P2,5¢AGCGGTCGACTCACTTGGCATGGCG AACAACAA3¢with the Sal I(GTCGAC),which have sites for EcoRI(GAATTC)and Sal I(GTCGAC)in forward and rever primers.Gel images were obtained and the densities of the PCR products were quantified using densitometry methods.
Expression and purification of fusion protein
li Rosta
PCR fragments were digested by EcoRI and Sal I and then cloned into the EcoRI and Sal I digested PHUE vector.Re-combinant plasmids were transformed li.Rosta and soluble fusion protein GPC3were produced after the induction of0.1mM isopropyl-1-thio-D-galactopyranside (IPTG)at37°C and220rpm for4h.The expresd fusion protein was purified with affinity chromatography via its His-tag and then ion exchange chromatography via protein charge.Purified fusion proteins were ud as immunogen and screening antigen in enzyme-linked immunosorbent assay(ELISA)for the identification of monoclonal antibody against GPC3.
Immunization,cell fusion,and screening
Three adult female BALB/c mice(8*10weeks of age)were injected intraperitoneally with500m L of a1:1GPC3fusion protein(100m g per mou)and complete Freund’s adjuvant (Sigma,St.Louis,MO)thefirst time and then boosted with the antigen in incomplete Freund’s adjuvant at2-week intervals. Before fusion,the mice were again boosted with100m g of the antigen in phosphate-buffered saline(PBS,pH7.2).Fusion to SP2/0myeloma cells was carried out using standar
电话营销d meth-odology.Fusion cells were resuspended in120mL RPMI1640 containing20%fetal calf rum and HAT.Then cell suspen-sions were plated on96-well plates and incubated overnight at37°C,5%CO2,95%humidity.Seven days later culture medium was replaced by RPMI1640containing20%fetal calf rum and HT.At day15,the wells were tested for positive colonies by indirect ELISA.96-well polystyrene plates were coated with30m g fusion protein and incubated at4°C over-night.The plates were washed three times with washing buffer(0.05%Tween-20in PBS).Then10%calf rum in PBS was added to the wells and the plates were incubated for1h at 37°C followed by washing as above.The culture supernatants of the hybridomas(100m L/well)were added to the wells (GPC3immune rum as a positive contrast,normal mou rum as a negative control)and incubated for1h at37°C. After washing,goat anti-mou IgG-HRP conjugate was ad-ded and incubated for1h at37°C.After treatment with washing buffer three times,100m L of the chromogenic reagent 3,3¢,5,5¢-tetramethylbenzidine(TMB)were added.After 20min,the reaction was stopped with2M H2SO4and at 450nm each well was measured by a microplate reader(Bio-Rad ELISA Reader,Tokyo,Japan).
Western blot analysis
For Western blot analysis,the proteins from the expression proteins and hepatoma cell lines Huh7,H
epG2,L02,SW480, and Hela were ud.After dealing with the protein sample, they were loaded per lane,electrophored in12%SDS-PAGE,and blotted on a PVDF membrane.The membrane was blocked with5%non-fat dried milk in TBST(10mM Tris-HCl [pH7.4],150mMNaCl)at4°C overnight.After washing three times for15min in TBST,the membrane was incubated with hybridoma culture supernatant for1h at room temperature. Followed by washing as above,goat anti-mou IgG-HRP was ud as a condary antibody at room temperature.The membrane was washed again and blots were visualized by ECL.
Production of monoclonal antibodies
In order to obtain a considerable number of antibodies, adult female BALB/c mice were injected with about105hy-bridoma cells in0.5mL of RPMI1640.Then a large number of ascites were produced within1–2weeks.The ascites were centrifuged at12000rmp for10min,and the supernatant was collected.描写人心情的成语
Classification of MAbs
The class and subclass of MAbs were determined using mou hybridoma subtyping kit(Boehringer Mannheim, Germany).
Purification of monoclonal antibodies
The ascites were diluted with PBS(pH7.2)at leastfive to six times.They were then purified by Protein G-Sepharo CI-4B (Pharmacia,Uppsala,Sweden).The Hit rap Protein G column was equilibrated with at least two column volumes of starting buffer(0.01M PBS,pH7.4).Then the sample was pumped into the column and washed with the starting buffer for5 column volumes and eluted with elution buffer(0.1M Gly-HCl,pH2.8)1–3column volumes.The purified antibodies were neutralized by a buffer(1.0M Tris-HCl,pH9.6).Flow rates of washing and equilibration were2mL/min,and rates of sample application and elution were1mL/min.
Immunofluorescence
After the collection of liver cancer cells Huh7,cells were spread on a glass slide and grown overnight.After washing in
456MA ET AL.
PBS,they were fixed with ice-cold paraformaldehyde and were blocked with 10%goat rum for 1h.After washing three times with PBS,the cells were incubated with 7D11for 1h at room temperatur
e with PBS as negative control.Followed by washing as above,fluorescent-labeled goat anti-mou was ud as a condary antibody at room temperature.Stained cells were obrved in the fluorescence microscopy.Immunohistochemistry
After pre-incubation of the sample with 5%bovine rum albumin (BSA)for 10min,anti-GPC3primary antibody (1:1000)was added and incubated at 4°C overnight.Location of the primary antibodies was achieved by subquent ap-plication of a biotinylated anti-primary antibody,an avidin-biotin complex conjugated to horradish peroxida,and diaminobenzidine (Dako,Glostrup,Denmark).The slides were counterstained by hematoxylin.Results
Expression and purification of fusion protein li Recombinant plasmid PHUE-GPC3was established and transformed into li Rosta.Fusion protein was expresd in bacteria with the induction of 0.1mM IPTG overnight at 37°C and 220rpm (Fig.1A).Expresd fusion proteins were purified using affinity chromatography via His-tag and achieved up to 95%purity determined by SDS-PAGE (Fig.1B).
ELISA analysis for MAb against GPC3
Hybridomas were cultured in 96-well culture microtitra-tion plates.In order to asss anti-GPC3antib
ody production,the supernatants were assayed after cell fusion for 11days.Sixteen hybridomas (1A1,1E1,2E11,4A8,4B8,4E12,5D6,5G7,7D10,7D11,7E9,7H7,8B2,8E7,8F10,8G6)were lected becau of their stability and specificity.Secretory hybridoma cells of antibodies were cloned and recloned three times to guarantee monoclonal behavior of the produced immuno-globulins.The stable hybridomas,designated as1A1,2E11,
4A8,4B8,4E12,5D6,5G7,7D10,7D11,7H7,8B2,8F10,and 8G6,were obtained after cell fusion and subcloning.All of the subclones were identified as IgG1a isotype and purified with protein G-Sepharo CI-4B resin under the condition of low salt and low pH (Table 1).
Western blot analysis of specific MAbs against GPC3In order to test the specificity of MAb against GPC3,Wes-tern blot analys of monoclonal antibodies were done using hybridoma supernatants as the primary antibody.Becau the GPC3protein ud in immunization was a prokaryotic protein,its structure might be somewhat different with the GPC3in eukaryotic cells.Therefore,the human liver cancer cell lines HepG2,Huh7,L02,SW480,and Hela were ud to examine the binding ability of MAb7D11with GPC3in eu-karyotic cells.The fusion protein GPC3,HepG2,and Huh7cells were subjected to SDS-PAGE and Western blot analysis with 7D11as the primary antibody.Western blotting results showed that the recombinant protein GPC3-His can be de-tected by anti-His antibody,
the recombinant protein GPC3-GST can be detected by anti-GST antibody (Fig.2A),and 7D11had specific binding ability with fusion protein GPC3(Fig.2B)and GPC3in eukaryotic cells (Fig.2C).Immunofluorescence analysis of specific MAbs against GPC3
The cells were obrved in fluorescence after staining by monoclonal antibody 7D11(Fig.3A)and no fluorescence after staining by PBS (Fig.3B).This result suggested that 7D11could be ud to detect GPC3protein expression level in liver cells.Immunohistochemistry analysis of specific MAbs against GPC3
In immunohistochemistry assay,HCC tissue,HCC adja-cent tissue,and liver abscess tissue were ud to determine the reactivity of MAb 7D11.There was little immunoreactivity obrved in HCC adjacent tissue and liver abscess tissue.Strong immunoreactivity was obrved in HCC
tissue.
FIG.1.(A )Expression of PHUE-GPC3.M,standard protein molecular weight;lanes 1–3,non-induction of PHUE-GPC3;lanes 2–4,induction of PHUE-GPC3.(B )SDS-PAGE analysis of purification of fusion protein PHUE-GPC3.M,standard protein molecular weight;lanes 1–3,penetration,cond wave of purification stage;lanes 4–8,purified protein.
MONOCLONAL ANTIBODY AGAINST GLYPICAN-3457
Discussion
GPC3,a membrane heparan sulfate proteoglycan,regu-lates the development of tissues and organs in the embryo and fetus negatively.The abnormal expression of GPC3in tumor development is cloly related to HCC after the birth;GPC3is highly expresd in the HCC state and can be detected in the early stage of liver cancer.In AFP negative hepatocellular carcinoma,GPC3has a certain expression rate,so GPC3can be ud for the early diagnosis of liver cancer.
In 1997Hsu and colleagues (22)first reported on the high expression of GPC3mRNA in HCC,followed by more re-archers confirming in GPC3that both mRNA and protein were shown to
be overexpresd in HCC and that this oc-curred in the early stage of HCC.(23)GPC3expression was also found in the HCC cell lines HepG2,Hep3B,and HuH-7(24)and in more than 70%of HCC tumors,but not in normal liver tissue.(5,6)Studies by Di Tommaso and co-workers (25)have shown that nsitivity is 69%,with a specificity of 91%in the diagnosis of early-stage HCC by detecting GPC3.
The differences of GPC3expression are obvious in HCC tissues and benign liver organizations.Llovet and col-leagues (26)reported that GPC3was expresd in 100%liver organization with the background of early liver cirrhosis in hepatitis C (<2cm liver nodules)and was not expresd in other benign liver dias and normal liver tissues.In com-paring the GPC3expression in HCC and ICC (intrahepatic cholangiocarcinoma)organization,Shirakawa and col-leagues (27)found that GPC3was expresd in 78.3%of HCC,but not expresd in ICC.The positive rate of rum GPC3protein was 40.0%(16/40)in liver cancer patients,patients with cirrhosis,and chronic hepatitis,and healthy controls had negative expression (0/13,0/34,0/60).(6)The level of rum GPC3was incread in 53%(18/34)of liver cancer patients,lower than the positive rate (72%)of HCC tissues.Only 1of 20patients with liver cirrhosis was high,while normal controls and hepatitis patients were negative.(5)
In AFP negative HCC,GPC3also has a higher expression rate.Ding and colleagues (28)detected GPC3mRNA in 41AFP-negative HCC tissues and adjacent noncancerous tissues.In cancer tissue,the positive rate was 73.17%,and in adjacent tissue,it was only 9.76%.Moreover,GPC3mRNA was weakly expresd;the expression rate was 79.31%in large hepatocellular carcinoma (>5cm),41.67%in small HCC (£5cm),76.47%in poorly differentiated carcinoma (III–IV class),42.86%in well-differentiated carcinoma (I–II level).Immunohistochemistry results showed that GPC3was ex-presd in hepatoma cells,negative in normal liver cells,bile
Table 1.ELISA Assay for Specificity of MAbs with Fusion Protein
Fusion cell screening
Third monoclonal screening Hybridomas OD450nm Positive control
Negative control
OD450nm Positive control
0x000000edNegative control
伤逝歌词
1A1 1.337 1.6360.187 1.491 1.5710.2192E110.841 1.6360.1870.980 1.1890.1544A80.889 1.6360.187 1.184 1.5710.2194B8 1.062 1.6360.1870.863 1.5710.2194E12 1.086 1.6360.187 1.017 1.1890.1545D6 1.702 1.6360.187 1.560 1.5710.2195G7 1.548 1.6360.187 1.387 1.5710.2197D10 1.171 1.6360.1870.931 1.5710.2197D11 1.658 1.6360.187 1.753 1.5710.2197H7 1.124 1.6360.1870.966 1.1890.1548B20.807 1.6360.187 1.161 1.5710.2198F10 1.912 1.6360.187 1.481 1.5710.2198G6
1.779
1.636
0.187
1.251
1.571
0.219
悉尼温度
FIG.2.(A )Western blot analysis of specific MAb against recombinant protein.Lane 1,recombinant protein GPC3-His by anti-His MAb;lane 2,recombinant protein GPC3-GST by anti-GST MAb.(B )Western blot analysis of specific MAb against GPC3recombinant protein.(C )Western blot analysis of specific MAb against GPC3in eukaryotic cells.Lane 1,HepG2cell;lane 2,Huh7cell;lane 3,SW480;lane 4,LO2;lane 5,Hela.
458
MA ET AL.
duct cells,endothelial cells,Ito cells,and fibroblasts.There are no significant correlations between rum GPC3and AFP levels,which is to a certain extent compensatory for the lack of AFP diagnosing for liver cancer.(5,29)Further,GPC3was found to be an abnce protein expression in CCA,indicating
that GPC3may be potentially ud as a diagnostic marker to distinguish between the two primary liver cancers too.(30)
GPC3expression status was also related to the prognosis of patients with hepatocellular carcinoma.In the study by Shirakawa and associates,107cas of
hepatocellular
FIG.3.Immunofluorescence analysis of specific MAbs against
田字开头的成语
GPC3.
FIG.4.CPC3expression in HCC tissue.(A ,B )HCC tissue.(C ,D )HCC adjacent tissue.(E ,F )Liver abscess tissue.
MONOCLONAL ANTIBODY AGAINST GLYPICAN-3459
