烤羊腿
Highly prevalent TERT promoter mutations in aggressive thyroid cancers Xiaoli Liu , Justin Bishop 1, Yuan Shan 2, Sara Pai 3, Dingxie Liu , Avaniyapuram Kannan Murugan , Hui Sun 4, Adel K El-Naggar 5, and Mingzhao Xing Laboratory for Cellular and Molecular Thyroid Rearch, Division of Endocrinology and Metabolism, Johns Hopkins University School of Medicine, 1830 East Monument Street, Suite 333, Baltimore, Maryland 21287, USA 1Department of Pathology, Johns Hopkins University School of Medicine, Baltimore, Maryland 21287, USA 2Departments of Anatomic Pathology and Neuro-Oncology, Moffitt Cancer Center, Tampa,Florida 33612, USA 3Department of Otolaryngology–Head and Neck Surgery, Johns Hopkins University School of Medicine, Baltimore, Maryland 21287, USA 4Jilin Provincial Key Laboratory of Surgical Translational Medicine, Department of Thyroid and Parathyroid Surgery, China-Japan Union Hospital, Jilin University, Changchun, Jilin Province 130033, China 5Department of Pathology, University of Texas MD Anderson Cancer Center, Houston, Texas
77030, USA
Abstract
Mutations 1 295 228 C>T and 1 295 250 C>T (termed C228T and C250T respectively),
corresponding to −124 C>T and −146 C>T from the translation start site in the promoter of the telomera rever transcripta (TERT ) gene, have recently been reported in human cancers, but not in thyroid cancers yet. We explored the mutations in thyroid cancers by genomic quencing of a large number of primary tumor samples. We found the C228T mutation in 0 of 85 (0.0%)benign thyroid tumors, 30 of 257 (11.7%) papillary thyroid cancers (PTC), 9 of 79 (11.4%)
follicular thyroid cancers (FTC), 3 of 8 (37.5%) poorly differentiated thyroid cancers (PDTC), 23of 54 (42.6%) anaplastic thyroid cancers (ATC), and 8 of 12 (66.7%) thyroid cancer cell lines. The C250T mutation was uncommon, but mutually exclusive with the C228T mutation, and the two mutations were collectively found in 11 of 79 (13.9%) FTC, 25 of 54 (46.3%) ATC, and 11 of 12(91.7%) thyroid cancer cell lines. Among PTC variants, the C228T mutation was found in 4 of 13(30.8%) tall-cell PTC (TCPTC), 23 of 187 (12.3%) conventional PTC, and 2 of 56 (3.6%)
follicular variant PTC samples. No TERT mutation was found in 16 medullary thyroid cancer samples. The C228T mutation was associated with the BRAF V600E mutation in PTC, being prent in 19 of 104 (18.3%) BRAF mutation-positive PTC vs 11 of 153 (7.2%) the BRAF
mutation-negative PTC samples (P =0.0094). Converly, BRAF mutation was found in 19 of 30(63.
3%) C228T mutation-positive PTC vs 85 of 227 (37.4%) C228T mutation-negative PTC samples (P =0.0094). We thus for the first time, to our knowledge, demonstrate TERT promoter © 2013 Society for Endocrinology
Correspondence should be addresd to M Xing mxing1@jhmi.edu.
君生我未生Declaration of interest M Xing received royalties as a co-holder of a licend USA patent related to the discovery and clinical characterization of BRAF V600E mutation in thyroid cancers.
NIH Public Access
Author Manuscript
Endocr Relat Cancer . Author manuscript; available in PMC 2013 September 24.Published in final edited form as:Endocr Relat Cancer . 2013 ; 20(4): 603–610. doi:10.1530/ERC-13-0210.NIH-PA Author Manuscript
NIH-PA Author Manuscript
NIH-PA Author Manuscript
mutations in thyroid cancers, that are particularly prevalent in the aggressive thyroid cancers
TCPTC, PDTC, ATC and BRAF mutation-positive PTC, revealing a novel genetic background for thyroid cancers.
Keywords TERT promoter mutations; thyroid cancers; BRAF V600E mutation; telomera rever transcripta; thyroid tumorigenesis
云朵符号Introduction
Telomera, a ribonucleoprotein complex that maintains telomere length at the end of chromosomes, plays a key role in cellular immortality and tumorigenesis (Smekalova et al .2012, Mocellin et al . 2013). Its catalytic subunit is telomera rever transcripta (TERT).Promoter mutations in the TERT gene on chromosome 5 have recently been reported in melanomas (Horn et al . 2013, Huang et al . 2013). Two TERT promoter mutations, 1 295228 C>T and 1 295 250 C>T (termed C228T and C250T here respectively), are particularly common. They reprent nucleotide changes of −124 C>T and −146 C>T (where −1 is the ba just upstream of the A of the ATG translation start site) respectively in the TERT promoter. Both the mutations create an 11-ba nucleotide stretch 5 -CCCCTTCCGGG-3 ,which contains a connsus binding site, GGAA (in revers
e complement), for ETS transcription factors, suggesting potentially important biological relevance of the mutations. In fact, the two mutations have been demonstrated to confer incread transcriptional activity on the TERT promoter (Horn et al . 2013, Huang et al . 2013). The mutations are not found in normal human subjects and in the public genetic databas and are, therefore, cancer-specific somatic genetic alterations, further supporting their potentially important role in human tumorigenesis. This is consistent with the previously obrved
incread telomera activities in some human cancers (Smekalova et al . 2012, Mocellin et
al . 2013). Thus, TERT promoter mutations, by promoting the expression of the catalytic
subunit of telomera in respon to ETS transcription factors, probably reprent a novel
mechanism by which telomera plays an important role in human tumori-genesis.
Melanomas and follicular cell-derived thyroid cancer share considerably similar genetic
backgrounds; for example, they both harbor the BRAF V600E mutation with a high
prevalence (Davies et al . 2002, Xing 2005a ). We were, therefore, prompted to explore
TERT promoter mutations in thyroid cancers in the prent study.
Follicular cell-derived thyroid cancer is a common endocrine malignancy the incidence of
which, similar to that of melanoma, has been rising rapidly globally in recent years (Jemal et
al . 2011, Howlader et al . 2012). Follicular cell-derived thyroid cancer can be classified into
veral histological types (DeLellis et al . 2004), among which the most common types are
papillary thyroid cancer (PTC) and follicular thyroid cancer (FTC), which account for 85–
90% and 10–15% of all the thyroid cancers respectively (DeLellis et al . 2004, Jemal et al .
2011, Howlader et al . 2012). PTC can be further classified into a few subtypes or variants,
the most common of which include conventional PTC (CPTC), follicular variant PTC
(FVPTC), and tall-cell PTC (TCPTC). Other subtypes of PTC, such as the columnar variant,
are rare. Unlike the rare but rapidly aggressive undifferentiated anaplastic thyroid cancer
(ATC; Smallridge et al . 2012), PTC and FTC are indolent differentiated thyroid cancers
(DTCs). There is also poorly differentiated thyroid cancer (PDTC), which has
aggressiveness between that of DTC and ATC. Parafollicular C-cell-derived medullary
thyroid cancer (MTC) is uncommon. Benign thyroid tumors are far more common than
香精怎么用
thyroid cancers. Various genetic alterations have been identified in thyroid cancers, which,
by aberrantly driving various signaling pathways, play a fundamental role in thyroid
NIH-PA Author Manuscript
NIH-PA Author Manuscript
NIH-PA Author Manuscript
tumorigenesis (Xing 2013). In the prent study, we examined TERT promoter mutations in
various thyroid tumors to explore novel genetic alterations in thyroid tumorigenesis.
Subjects and methods Thyroid tumor tissues, cell lines, and DNA Genomic DNA was isolated from thyroid tumor tissues and cell lines using standard procedures of proteina K digestion, phenol–chloroform extraction, and ethanol precipitation. U of human thyroid tissues was bad on Institutional Review Board-approved protocols and written patient connt was obtained where appropriate. The study included 85 benign thyroid tumors, 257 PTC (consisting of 187 CPTC, 56 FVPTC, 13TCPTC, and 1 columnar PTC), 79 conventional FTC, 8 PDTC, 54 ATC, and 16 MTC samples. Thyroid cancer cell lines included TPC1, C643, Hth7, FTC133, OCUT-1, K1, FB1,BCPAP, SW1736, KAT18, Hth74, and WRO. Their thyroid tumor origins are given in Table 1.Identification of TERT promoter mutations Standard PCR was carried out for genetic quencing to identify TERT promoter mutations.Briefly, a fragment of the TERT promoter was amplified by PCR on genomic DNA using primers 5 -AGTGGATTCGCGGGCACAGA-3 (n) and 5 -CAGCGCTGCCTGAAACTC-3 (antin). This resulted in a PCR product of 235 bp,containing the sites where mutations C228T and C250T occur in melanomas (Horn et al .2013, Huang et al . 2013). About 40–50 ng of genomic DNA were ud in the PCR, which was carried out with an initial denaturation step at 95 °C for 3 min, followed by ten cycles of 95 °C denaturation for 30 s, 55 °C annealing for 30 s, and 68 °C elongation for 1 min. This was then followed by 30 cycles of the same ttings except for elongation for an additional 5s in each cycle. The PCR was completed with a final
elongation step at 68 °C for 7 min.Following quality confirmation of the PCR products by gel electrophoresis, quencing PCR
was carried out using a Big Dye terminator v3.1 cycle quencing ready reaction kit
(Applied Biosystems) and an ABI PRISM 3730 automated next generation genetic analyzer
(Applied Biosystems) at the Johns Hopkins' quencing facility. When a mutation was
identified by Big Dye quencing using the n primer, the reaction was repeated using the
antin primer to confirm the mutation.
Identification of BRAF V600E mutation
The BRAF V600E mutation was analyzed as described previously (Hu et al . 2006). Briefly,
exon 15 of the BRAF gene containing the site for the T1799A (V600E) mutation was PCR-
amplified using primers TCATAATGCTTGCTCTGATAGGA (n) and
GGCCAAAAATTTAATCAGTGGA (antin), resulting in a 212 bp product. The PCR
ttings included one cycle of 95 °C for 5 min; two cycles of 95 °C for 1 min, 60 °C for 1
min, and 72 °C for 1 min; two cycles of 95 °C for 1 min, 58 °C for 1 min, and 72 °C for 1
min; and 35 cycles of 95 °C for 1 min, 56 °C for 1 min, and 72 °C for 1 min, followed by an
extension step at 72 °C for 5 min. After quality confirmation by agaro gel electrophoresis,
the PCR products were subjected to Big Dye reaction and quencing analysis as described
above for TERT mutations. All the mutations were confirmed using both the n and我的成长计划
antin primers.
苏维埃政府旧址Results
Prevalence of TERT promoter mutations in thyroid cancer cell lines and thyroid tumors
In Fig. 1, reprentative electropherograms of the two TERT promoter mutations in thyroid
cancer cell lines and various primary thyroid cancer tumor samples detected by both n
NIH-PA Author Manuscript
NIH-PA Author Manuscript
NIH-PA Author Manuscript
(Fig. 1A) and antin (Fig. 1B) primers are shown. In Table 1, the TERT promoter
mutation status of the 12 individual thyroid cancer cell lines tested is summarized. Except for the WRO cell line that harbored the wild-type TERT promoter, all the remaining 11
thyroid cancer cell lines examined harbored TERT promoter mutations. PTC and FTC cell lines only harbored the C228T mutation, while the ATC cell line harbored both the C228T and C250T mutations. Table 2 summarizes TERT promoter mutations found in all the
thyroid cancer cell lines and primary thyroid tumors. The two mutations were collectively found in 11 of the 12 (91.7%) thyroid cancer cell lines. The C228T mutation was found in 0of 85 (0.0%) benign thyroid tumor, 30 of 257 (11.7%) PTC, 9 of 79 (11.4%) FTC, 3 of 8(37.5%) PDTC, and 23 of 54 (42.6%) ATC samples. Among the three variants of PTC, the C228T mutation was found in 4 of 13 (30.8%) TCPTC, 23 of 187 (12.3%) CPTC, and 2 of 56 (3.6%) FVPTC samples. The single columnar
PTC sample examined was positive for the C228T mutation. The C250T mutation was not found in the PTC sample, but was found in two FTC, two ATC, and three ATC cell lines. The two TERT promoter mutations were
中国书协mutually exclusive in both thyroid cancer cell lines and thyroid cancer tumor samples and collectively found in 11 of 79 (13.9%) FTC, 25 of 54 (46.3%) ATC, and 7 of 7 (100%) ATC cell lines. No TERT promoter mutation was found in 16 MTC samples. Three cas had both PTC and ATC in the same thyroid gland, and in each ca, both the PTC and ATC
harbored the C228T mutation. Three melanoma cell lines (M14, A375, and UACC62)
examined harbored the C250T mutation (data not shown), as found in other melanoma cell lines (Horn et al . 2013, Huang et al . 2013). All the TERT mutations in the tumor samples were heterozygous, and some cell lines harbored a homozygous C228T or C250T mutation (Table 1). We also found a C>T mutation at position chromosome 5: 1 295 229, which is adjacent to the C228T mutation, resulting in a CC>TT tandem mutation in the BCPAP cell line (Fig. 1A). This is similar to the occasional finding of this tandem mutation in
melanomas (Horn et al . 2013, Huang et al . 2013). A germline A>C (T>G on opposite
strand) mutation at −57 bp from the ATG translation start site of the TERT gene was found in familial melanomas (Horn et al . 2013), but we did not find this mutation in any of the thyroid tumor samples or cell lines in the prent study. We also did not find this mutation and other TERT promoter mutations in the peripheral blood DNA of 18 patients with
familial PTC from a previous study (Xing 2005b ).计较的读音
Association of TERT promoter mutations with aggressive types of thyroid cancers
CPTC, FVPTC, and TCPTC account for the vast majority of PTC variants. TCPTC is
classically known to be more aggressive than CPTC and FVPTC. As shown in Table 3,
TERT promoter mutations were significantly more prevalent in the TCPTC samples than in the CPTC and FVPTC samples, 30.8% (4/13) in the former vs 10.3% (25/243) in the latter two (P =0.046, per two-tailed Fisher's exact test). TERT promoter mutations were highly
significantly more prevalent in the ATC samples than in the DTC samples, 46.3% (25/54) in the former vs 12.2% (41/336) in the latter (P =3×10−8). There was a trend towards a higher prevalence of TERT promoter mutations in the PDTC samples than in the DTC samples,37.5% (3/8) in the form
er vs 12.2% (41/336) in the latter (P =0.069). Statistical significance was not reached, probably due to the relatively small number of PDTC samples.
Association of TERT promoter mutation C228T with BRAF V600E mutation in PTC BRAF V600E mutation, which activates the MAPK pathway, is the most common mutation in thyroid cancers, particularly in PTC (Xing 2005a ). We, therefore, analyzed the
relationship between this mutation and TERT promoter mutation C228T in PTC. As shown in Table 4, TERT promoter mutation C228T more commonly occurred in the PTC samples harboring the BRAF V600E mutation than in the PTC samples harboring the wild-type
BRAF gene, with a prevalence of 18.3% (19/104) in the former vs 7.2% (11/153) in the
latter (P =0.0094, per two-tailed Fisher's exact test). Converly, BRAF mutation more
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
commonly occurred in the PTC samples harboring the TERT promoter mutation than in the PTC samples harboring the wild-type TERT , 63.3% (19/30) in the former vs 37.4% (85/227)in the latter (P =0.0094). Thus, the majority of the TERT promoter mutation-positive PTC samples harbored the
BRAF V600E mutation. Several cas of ATC had both BRAF V600E and TERT mutations, but the relationship of the two types of mutations could not be statistically analyzed in this cancer due to the small number of BRAF mutation-positive cas (Table 4).Discussion
The recent discovery of TERT promoter mutations in melanomas is the first example, to our knowledge, indicating that mutations in gene promoters may also play an important oncogenic role (Horn et al . 2013, Huang et al . 2013). This reprents a novel genetic mechanism in human tumorigenesis. A subquent report of the existence of TERT promoter mutations in other human cancers (Killela et al . 2013) and our report on the high prevalence of the mutations in bladder cancer and glioblastoma (Liu et al . 2013) suggest that TERT promoter mutations may play a huge role in human tumorigenesis. We report here for the first time, to our knowledge, that common TERT promoter mutations are also in obrved thyroid cancer.We found no TERT promoter mutations in para-follicular C-cell-derived MTC samples,consistent with similar findings in a recent study on 24 MTC samples (Killela et al . 2013).However, due to the relatively small number of samples examined, the status of TERT promoter mutations in MTC cannot be definitively concluded. In contrast, in the analysis of a large cohort of follicular cell-derived thyroid cancer samples in the prent study, we found a common occurrence of TERT promoter mutations in both PTC and FTC s
amples,suggesting a role of the mutations in the tumorigenesis of a subgroup of the DTCs. The lack of TERT promoter mutations in benign thyroid tumor samples suggests that the
mutations are malignancy-specific and may be relatively late genetic events along the line of thyroid tumorigenesis. Consistent with this idea is the strikingly higher prevalence of TERT promoter mutations in PDTC and ATC than in DTCs; PDTC and ATC have partially and completely lost differentiation respectively and are the most aggressive thyroid cancers. This rais the possibility that TERT promoter mutations may play a particular role in the de-differentiation of DTCs and hence their conversion to poorly or undifferentiated aggressive thyroid cancers. This possibility is consistent with the finding in three cas in which co-
existing PTC and ATC in the same thyroid gland harbored TERT promoter mutation C228T.The prevalence of TERT promoter mutations was extremely high in thyroid cancer cell lines (91.7%), which is in contrast to the low prevalence of 16% (24/150) in general cancer cell lines from the Cancer Cell Line Encyclopedia (Huang et al . 2013), but is similar to the high prevalence of 74% (125/168) in melanoma cell lines (Horn et al . 2013). This result is again consistent with the idea that TERT promoter mutations may play a role in the de-
differentiation of thyroid cancer cells since thyroid cancer cell lines in culture commonly become de-differentiated (van Staveren et al . 2007). Interestingly, among the three common variants of PTC, TCPTC harbored TERT promoter mutations with the highest prevalence.TCPTC is a relatively uncommon but more aggressive PTC variant than CPTC and FVPTC (Xing et al . 2005, Ghosin et al . 2007, LiVolsi 2010). It is possible that TERT promoter mutations play a role in the aggressiveness of this unique PTC variant. This is again
consistent with the idea that TERT promoter mutations may play a role in the development of progression and aggressiveness of thyroid cancers.
As in many other human cancers in which telomera activities are incread (Smekalova et al . 2012, Mocellin et al . 2013), incread telomera activities have also been found in
thyroid cancers but not in normal thyroid tissues or benign thyroid tumors, suggesting a role NIH-PA Author Manuscript
NIH-PA Author Manuscript
NIH-PA Author Manuscript
