Product:pP RO EX HT Prokaryotic Expression System
Cat. No.:10711-018Storage Conditions: 4°C
Size: 10 reactions Description:
The pP RO EX HT Prokaryotic Expression System is designed for the expression of foreign proteins in E. coli (1). The protein is expresd fud to a 6 histidine quence (His)6 for affinity purification. The gene of interest is cloned into the multiple cloning site (MCS) of either pP RO EX HTa, pP RO EX HTb, or pP RO EX HTc. Upon expression, the histidine quence is at the amino terminus of the fusion prot
ein. The histidine quence has a strong affinity for Ni-NTA resin matrix (2), making it simple to purify the desired protein (3). The vector also encodes the quence for the Tobacco Etch Virus (TEV) protea cleavage site (4-8). rTEV Protea (Cat. No. 10127-017) can be ud to remove the histidines from the fusion protein.
Component (e notes 1 and 2) Part No. Concentration Amount
Plasmid pP RO EX HTa506090.5 µg/µl10 µg
Plasmid pP RO EX HTb506100.5 µg/µl10 µg
Plasmid pP RO EX HTc506110.5 µg/µl10 µg
Control DNA pP RO EX HT-CAT50613 1 ng/µl15 ng
Ni-NTA Resin Y0228110 ml
Column one
Plasmid pP RO EX HTa, pP RO EX HTb, and pP RO EX HTc:
The three pP RO EX HT vectors contain a 6x histidine affinity tag for ea of purification, a 7-amino acid spacer arm, the TEV protea recognition site for cleavage of the 6x histidines from the protein, and an extensive multiple cloning site. The DNAs differ from each other with respect to their reading frames relative to the 6x histidine affinity tag. The trc promoter and lac I q gene enable inducible expression of a cloned gene with IPTG. The plasmids also contain the pBR322 origin of replication, the β-lactama gene conferring ampicillin resistance (Ap r), and the bacteriophage F1 origin of replication (F1 intergenic
region) for the synthesis of single stranded DNA in conjunction with the appropriate helper phage (9). The vectors cannot be ud for blue/white screening
in the prence of X-gal.
Control DNA pP RO EX HT-CAT:
The control DNA pP RO EX HT-CAT contains the chloramphenicol acetyl transfera gene (CAT) cloned into the Ehe I site of the plasmid pP RO EX HTa. To verify that your expression system is operating properly, transform 100 µl of S UBCLONING E FFICIENCY DH5α Competent Cells (Cat. No. 18265-017) with 5 µl of the pP RO EX HT-CAT plasmid according to the protocol supplied with th
e cells. The transformants can be lected on plates containing LB + 100 µg/ml ampicillin.
Ni-NTA Affinity Resin (e notes 1-3 on page 4 for additional information):
The Ni-NTA resin is supplied as a 50% slurry in 30% ethanol. Protein purification using this resin is bad on the principles of immobilized metal chelate affinity chromatography (8). The NTA (nitrilo-tri-acetic acid) ligand occupies four of the six ligand binding sites of Ni2+, leaving 2 sites free for interaction with the histidines. The resin is reusable 3-5 times.
GROWTH AND INDUCTION OF RECOMBINANT pPROEX HT CLONES
Before cloning into the pP RO EX HT expression vectors, determine which vector is appropriate so that your protein will be in the correct reading frame. Digest the pP RO EX HT DNA and the gene of interest with the appropriate restriction endonucleas to prerve the reading frame of the protein, then ligate the DNAs. Transform S UBCLONING E FFICIENCY DH5α Competent Cells (Cat. No. 18265-017) or MAX E FFICIENCY DH10B Competent Cells (Cat. No. 18297-010) with the ligated DNA (100 µl of cells per cloning reaction) following the procedure specified with the cells. Grow the transformants in LB + 100 µg/ml ampicillin overnight, and then isolate plasmid DNA using the standard mini-preparation procedure (11). Verify that the target gene has been cloned correctly befo
儒家智慧
re inducing the expression of the cloned gene as described below.
Small Scale Induction of Recombinant pP RO EX HT:
1.Inoculate 2 ml of LB media + 100 µg/ml ampicillin with a single colony. Incubate the culture overnight at 37°C with agitation., e note 4.
2.The next day, inoculate 10 ml of LB media + 100 µg/ml ampicillin with 0.1 ml of overnight culture. Grow at 37°C with agitation., e note 4.
3.When the culture reaches an A590 of 0.5-1.0, remove 1 ml and centrifuge for 1 min in a microcentrifuge. Discard the supernatant and resuspend the cells in
100 µl of PBS (Cat. No. 10010-015). This will be the uninduced sample.
4.To the remaining culture, add IPTG to a final concentration of 0.6 mM and continue to incubate the culture as described above.
5.Remove 1-ml aliquots of cells 1, 2 and 3 h after induction and measure the A590. Centrifuge the cells as above and resuspend the pellets in 100 µl of PBS.
The will be the induced samples.
6.Place 0.2 A590 of each sample in a parate microcentrifuge tube and mix with an equal volume of 2X SDS sample buffer [125 mM Tris-HCl (pH 6.8),
4% (w/v) SDS, 20% (v/v) glycerol, 0.01% (w/v) bromophenol blue]. Boil the samples and analyze them by SDS-polyacrylamide gel electrophoresis.
Doc. Rev.: 09/01/00
Figure 1. Map and multiple cloning sites of pP RO EX HT expression vectors. The schematic of pP RO EX HTa (4750 bp) with lected single digestion restriction endonucleas is prented. A similar schematic can be drawn for the other two vectors except that pP RO EX HTb is 4778 bp and pP RO EX HTc is 4779 bp. The additional bas for pP RO EX HTb and pP RO EX HTc reflect the inrtion of a diagnostic restriction site at the Bst 1107 I site (+). In addition, the sites after Hin d III (*) are shifted by +1 and +2 bas for pP RO EX HTb and pP RO EX HTc, respectively. The multiple cloning sites (MCS) for the 3 vectors are shown above. The quence for the (his)6, spacer region and recombinant TEV protea cleavage site are underlined. The cleavage with TEV protea occurs between the gln and gly and is signified by (**). The shift in reading frame occurs at the Bam H I site in each vector. The added ba(s) are shown in bold. The stop codon for each vector is underlined and italicized. The M13/pUC Rever 23-Ba Sequencing Primer (AGCGGATAACAATTTCACACAGG) can be ud to quence clones. The 3′-end of the oligonucleotide is the AGG of the RBS.
***There are two Sph I sites in the vectors.
NOTE: The quence has not been confirmed by quence analysis. It was asmbled from the known quence of fragments ud to construct the vector. The most up-to-date restriction endonuclea information can be found on the Internet at
三角眼的女人面相Large Scale Induction of Recombinant pP RO EX HT:
Using the optimal induction times determined above, scale up the procedure for purification of the protein as follows:
1.Inoculate 10 ml of LB media + 100 µg/ml ampicillin with a single colony. Incubate the culture overnight at 37°C with agitation.
2.The next morning, inoculate 500 ml of LB media + 100 µg/ml ampicillin with 5 ml of the overnight culture. Incubate the culture at 37°C with agitation.
3.When the culture reaches an A590 of 0.5 - 1.0, remove a sample prior to induction to rve as an uninduced control. Induce the remaining culture with IPTG
(to 0.6 mM) and continue to incubate the culture at 37°C bad upon the optimal time determined above.
4.At end of the induction period centrifuge the cells at 10,000 x g for 10 min. Decant the supernatant fluid, determine the wet weight of cells, and store at
多风的英语-70°C until ready for protein purification.
PURIFICATION OF 6X HISTIDINE AFFINITY-TAGGED PROTEINS
The expresd protein can be purified with either a Tris-bad buffer system or a phosphate-bad buffer system. In general, proteins purified with the Tris-bad system have fewer contaminants. However, if your protein is nsitive to pH > 8.0, the phosphate system can be ud with satisfactory results. Becau the pH of Tris buffers vary with temperature, the pH of the Tris buffer system must be determined at the temperature at which the column will run. Phosphate buffers are not as nsitive to temperature.
•Do not u DTT in buffers. This chemical will reduce the Ni2+ ions.
•Do not u EDTA or other chelating agents in buffers. The chemicals will chelate the Ni2+ ions.
•When analyzing samples on SDS-polyacrylamide gels, fractions containing imidazole should be heated to 37°C for 10 min instead of boiling. This will avoid imidazole mediated cleavage of labile peptide bonds.
Preparation of Extracts
1.Resuspend the cells in 4 volumes of lysis buffer [50 mM Tris-HCl, (pH 8.5 at 4°C), 5 mM 2-mercaptoethanol, 1 mM PMSF], e note 5.
2.Sonicate the suspension until 80% of the cells are lyd. Remove 500 µl and save. Label sample as “crack”, e note 6.
3.Remove the cell debris by centrifugation.
4.Transfer the supernatant fluid to new tube. This is your CRUDE SUPERNATANT.
5.Save the pellet, e note 7.
Affinity Chromatography
If using a Tris buffer:
1.Equilibrate the column with Buffer A [20 mM Tris-HCl (pH 8.5 at 4°C), 100 mM KCl, 5 mM 2-mercaptoethanol, 10% glycerol, 20 mM imidazole) [e note
8].
2.Maintain a flow rate of 0.5 ml/min.
3.Load the sample from step 4 (the crude supernatant) on the column.
4.Wash the column with 10 volumes of Buffer A.
5.Wash the column with 2 volumes of Buffer B [20 mM Tris-HCl (pH 8.5 at 4°C), 1 M KCl, 5 mM 2-mercaptoethanol, 10% glycerol]
6.Wash the column with 2 volumes of Buffer A.
7,Elute bound proteins with Buffer C [20 mM Tris-HCl (pH 8.5 at 4°C), 100 mM KCl, 5 mM 2-mercaptoethanol, 10% glycerol, 100 mM imidazole], e note 8.
8.Collect 0.5 volume fractions.
If using a phosphate buffer:
1.Equilibrate the column with Buffer D [50 mM potassium phosphate (pH 6.0 at 25°C), 300 mM KCl, 10% glycerol, 5 mM 2-mercaptoethanol].
2.Maintain a flow rate of 0.5 ml/min.
3.Load the sample from step 4 (the crude supernatant) onto the column.
4.Wash the column with 10 volumes of Buffer D.
5.Elute bound proteins with Buffer E [50 mM potassium phosphate (pH
6.0 at 25°C), 300 mM KCl, 10% glycerol, 5 mM 2-mercaptoethanol, 100 mM
imidazole].
6.Collect 0.5 volume fractions.
Quick (Batchwi) Purification Protocol
1.Prepare the Tris buffers A and C. Remember it is critical that pH of Tris buffer be pH 8.5 at 4°C.
2.Prepare the extract as described above.
3.Transfer 500 µl of the crude extract to a new tube.
4.Add 200 µl of a 50% slurry Ni-NTA resin pre-equilibrated with Buffer A, e note 9.
5.Mix the suspension continuously for 20 min at 4°C.
6.Centrifuge the suspension for 1 min and transfer the supernatant to new tube. This is the material that does not bind to the resin.
7.Add 1 ml of Buffer A to the resin.
8.Mix the suspension for 5 min at 4°C.
9.Centrifuge the suspension for 1 min and transfer the supernatant to new tube and save. This is the wash fraction.
10.Repeat Steps 7-9.
11.Elute the protein with 3×200-µl aliquots of Buffer C. Mix each aliquot with the resin for 5 min, then
centrifuge the sample 1 min in a microcentrifuge
tube. Transfer the supernatant to a new tube. This is the eluted protein fraction.
REGENERATION OF THE NI-NTA RESIN
The number of times the Ni-NTA resin can be reud depends on the nature of the samples that have been previously run on the matrix. For best results, only purify identical recombinant proteins 3-5 times with the same batch of resin. If the Ni-NTA resin will be ud to purify a different recombinant protein, regenerate the ud resin according to the following procedure. Additionally, if the resin changes in color from light blue-green to brownish gray, u fresh resin or regenerate it before using it again.
Wash the column in the following order with:
1. 2 volumes of 6 M guanidine hydrochloride/0.2 M acetic acid
2. 2 volumes of water
3. 3 volumes of 2% SDS
闲人免入
4. 1 volume of 25% EtOH
5. 1 volume of 50% EtOH
6. 1 volume of 75% EtOH
7. 5 volumes of 100% EtOH
8. 1 volume of 75% EtOH
9. 1 volume of 50% EtOH
10.1 volume of 25% EtOH.
11.1 volume of water
12.5 volumes of 100 mM EDTA, pH 8.0
13.2 volumes of water
14.2 volumes of 100 mM NiSO4
15.2 volumes of water
16.2 volumes of 6 M guanidine hydrochloride/0.2 M acetic acid.
Equilibrate the column in Buffer A or Buffer D, depending on the buffer system to be ud with your recombinant protein.
Quality Control:
去屑止痒This product has pasd the following quality control: Verification of restriction endonuclea sites in the MCS and vector. pP RO EX HT-CAT Control DNA is tested to ensure the DNA transforms DH5α. Binding capacity of Ni-NTA resin for a His tagged protein is verified at 4-8 mg per 1 ml of resin.
Notes:
1.Vectors and resin are manufactured for Life Technologies by QIAGEN Inc.
2.This kit is provided with a licen for rearch u only. Information in respect of licens to u the products contained in this kit for purpos other than
rearch may be obtained from F. Hoffmann-La Roche Ltd., Corporate Licensing, 4002 Bal Switzerland.
3.Additional Ni-NTA resin may be purchad from QIAGEN Inc., 9600 De Soto Ave., Chatsworth, CA 91311. (800-426-8157).
4.Lowering the temperature to 20°C-30°C may help stabilize the induction of a given clone and result in higher protein yield. Better induction results are
generally obtained with fresh bacterial cultures. Inoculation of a culture from a plate that is veral days old may give low yield of protein upon induction.
5.Add freshly-made PMSF to the solution since PMSF los effectiveness within 30 min of dilution into an aqueous solution.
6.To calculate % cell lysis, dilute 5 µl of cell suspension prior to sonication in 995 µl of water and measure the absorbance at 590 nm (= A initial). Sonicate the
九女墩
cells and dilute 5 µl of sonicated cells in 995 µl of water and measure the absorbance at 590 nm (= A final ). The proportion of cells lyd is given by
% cells lyd = 1 - (A final / A initial )
7.Some proteins may be insoluble after induction. To determine if a protein is insoluble, resuspend the pellet (~5-10 O.D. of cells) in 1 ml lysis buffer.
Sonicate to ly cells and centrifuge for 2 min to pellet cell debris. Decant the supernatant and save on ice (this reprents the soluble protein fraction).
Resuspend the pellet in 1 ml lysis buffer (this is the insoluble protein fraction). Mix (15-25 µl) samples with an equal volume of 2X protein loading buffer and electrophore samples on an SDS-polyacrylamide gel.
2的英语
8.The salt concentration can be incread to 500 mM to improve protein purity.
9.The resin is equilibrated as follows: Mix the resin in the bottle well and pipet 1 ml of the slurry into a microcentrifuge tube. Centrifuge the resin for 30 c
and remove the supernatant. Add 500 µl equilibration buffer (either buffer A or buffer D) and mix well. Allow resin to incubate on ice for 5 min. Re-centrifuge resin and remove supernatant. Add 500 µl equilibration buffer and mix well. Resin is now ready for u.
References:
1.Polayes, D.A. (1996) F OCUS , 18, 50.
2.Hochuli, E., Dobeli, H., and Schacher, A. (1987) J. of Chromatography 411, 177.
3.Hoffman, A. and Roeder, R.G. (1991) Nucleic Acids Res. 19, 6337.
4.Dougherty, W.G. and Parks, T.D. (1989) Virology 172, 14
5.
5.Dougherty, W.G., Carrington, J.C., Cary, S.M. and Parks, T.D. (1988) EMBO J. 7, 1281.
6.Carrington, J.C. and Dougherty, W.G. (1988) Proc. Natl. Acad. Sci. USA 85, 3391.
7.Parks, T.D., Leuther, K.K., Howard, E.D., Johnston, S.A., and Dougherty, W.G. (1994) Anal. Biochem. 216, 413.
小老虎的简笔画8.Polayes, D.A., Goldstein, A., Ward, G. and Hughes, A.J., Jr (1994) F OCUS 16, 2.
9.Lin, J.J., Smith, M., Je, J., and Bloom, F. (1992) Biotechniques 12, 718.
10.Arnold, F.H. (1991) Bio/Technology 9, 151.
11.Sambrook, J., Fritsch, E.F., Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
Limited Label Licen No. 22:
Vectors are manufactured for Life Technologies, Inc. by QIAGEN, Inc. This product is provided with a licen for rearch u only. Information in respect of licens to u the product for purpos other than rearch may be obtained from F. Hoffmann-La Roche Ltd., Corporate Licensing, 4002 Bal Switzerland. Ni-NTA resin may be purchad form QIAGEN, Inc., 9600 De Soto Ave., Chatsworth, California 91311. (800-426-8157).
