Molecular tagging and mapping of the erect panicle gene in rice
Fan Na Kong ÆJia Yu Wang ÆJi Cheng Zou ÆLi Xue Shi ÆDe Min Jin ÆZheng Jin Xu ÆBin Wang
Received:2September 2006/Accepted:10October 2006/Published online:6December 2006ÓSpringer Science+Business Media B.V.2006
Abstract Erect panicle (EP)is one of the more important traits of the propod ideotype of high-yielding rice.Several rice cultivars with the EP phenotype,which has been reported to be con-trolled by a dominant gene,have been success-fully developed and relead for commercial production in North China.To analyze the inheritance of the EP trait,we generated gre-gating F 2and BC 1F 1populations by crossing an EP-type variety,Liaojing 5,and a curved-panicle-type variety,Fengjin .Our results confirmed that a dominant gene controls the EP trait.Simple-quence repeat (SSR)and bulked gregant analys of the F 2population revealed that the EP gene is located on chromosome 9,between two newly developed SSR markers,RM5833-11and RM5686-23,at a genetic distance of 1.5and手机开机慢怎么办
0.9cM,respectively.Markers clor to the EP gene were developed by amplified fragment length polymorphism (AFLP)analysis with 128AFLP primer combinations.Three AFLP mark-ers were found to 宇宙演化
be linked to the EP gene,and the nearest marker,E-TA/M-CTC 200,was mapped to the same location as SSR marker RM5686-23,1.5cM from the EP gene.A local map around the EP gene comprising nine SSR and one AFLP marker was constructed.The markers will be uful for marker-assisted lec-tion (MAS)for the EP trait in rice breeding programs.
Keywords AFLP ÁEP gene ÁMolecular markers ÁSSR
Introduction谷丙转氨酶偏高的原因及危害
The first breakthrough in increasing rice yield was the development of the midwarf cultivar.The breeding of super-high-yielding rice lines has been the focus of rice breeders since the end of last century.One of the more important aspects for the breeding of super-rice lines has been the improvement of the plant type,denoted as ideotype breeding.Breeding programs aimed at developing dwarf or ideotype lines are mostly concerned with improving parts of the plant,such as the stem,leaf and tiller.More recently,
F.N.Kong ÁL.X.Shi ÁD.M.Jin ÁB.Wang (&)The State Key Laboratory of Plant Genomics,Institute of Genetics and Developmental Biology,Chine Academy of Sciences,Beijing 100101,China e-mail:bwang@genetics.ac
F.N.Kong
The Graduate School of Chine Academy of Sciences,Beijing 100039,China
J.Y.Wang ÁJ.C.Zou ÁZ.J.Xu (&)
College of Agronomy,Shenyang Agricultural University,Shenyang 110161,China e-mail:
Mol Breeding (2007)19:297–304DOI 10.1007/s11032-006-9062-x
however,panicle traits,such as spike number, panicle length and spike density,have received much attention,but to date little information on the erect panicle(EP)type has been reported.
书法瘦金体In the1960s,the EP phenotype in a wheat line was found to reduce the amount of shading and confer a high photosynthetic capacity,while curved panicles(CP)appeared to reduce the efficiency of the line with respect to the utilization of light energy(Yin1961;Donald 1968).Twenty years later,an EP-type rice variety Liaojing5with a high yield was devel-oped and grown commercially(Xiong and Wang1992).Subquent studies have provided some evidence that rice EP-type plants can utilize solar energy effectively,improve ecolog-ical conditions,such as canopy illumination, temperature,hum
idity and CO2,and increa population growth rate,which would ultimately increa yield(Gao et al.1999),while CP-type rice plants have been reported to lodge more easily than their EP counterparts(Du and Fang 2004).This led to the model of EP and super-high yield being the aim in Japonica breeding; validation of this strategy has been the success-ful development of another high-yielding EP-type variety,Shennong265,which is successfully cultivated throughout the northern part of China.
Although the EP trait has been extensively propagated,there has been little advancement in the study of the EP gene.In the northern part of China,the EP gene mostly originates from Balilla,an old Italian variety that is reprentative of the EP type(Zhang et al. 2002).Field statistical results obtained from crossing EP-type Liaojing5with CP-type Fengjin and Shennong129indicated that a dominant gene controlled the EP trait(Xu et al.1995).However,information on linkage markers and the chromosome location of the EP gene is currently lacking.Conquently,the objectives of this study were to tag and map the EP gene using molecular markers and to develop a linkage map of the area encompass-ing the EP gene.This information will provide valuable tools for marker-assisted lection (MAS)in rice EP breeding and further molec-ular cloning of the EP gene.Material and methods
Plant materials
EP parent Liaojing5was crosd with CP parent Fengjin.The progeny of this cross were ud to develop an F2population,and a BC1F1popula-tion with CP parent Fengjin.Rice plants were cultivated in the experimentalfield of Shenyang Agricultural University under natural growing conditions.
Scanning electron microscopy
Samples were prepared as described previously (Mou et al.2000;Zhong et al.1997;Zhong and Ye1999),with some modifications.Briefly,stem tissues of rice panicles were excid with a razor and immediately placed in2.5%glutaraldehyde, dehydrated in ethanol and then dried in a Samdri point dryer(Hitachi,Tokyo,Japan).The samples were coated with gold using E-1010ion sputter (Hitachi)and obrved with a scanning electron microscope(S-3000N;Hitachi).
Statistical and genetic analys
The numbers of EP plants and CP plants in the F2 and BC1F1populations were counted and calcu-lated.v2tests were performed to determine whether the goodness-of-fit was a ratio of3:1in the F2populations and a ratio of1:1in BC1F1 populations.
DNA isolation
Leaves from parent,BC1F1and F2plants were harvested and DNA extracted using the standard sodium dodecyl sulfate(SDS)method(McCouch et al.1988).The DNA concentration was ad-justed to100ng l l-1with TE buffer(pH8.0)for subquent analys.
特别的英语Simple quence repeats(SSR)analysis
Bulked gregant analysis(BSA;Michelmore et al.1991)was performed in conjunction with the SSR analysis.The SSR analysis was carried out in a1·volume of reaction buffer containing
0.1mM of each dNTP,1.0U Taq polymera,0.2l M primer and 20ng template DNA;the final volume was adjusted to 20l l with ultra-pure water and one drop of mineral oil was added.The amplification reaction consisted of one cycle at 94°C for 4min,followed by 35cycles at 94°C for 45s,55°C for 45s,72°C for 1min,with a final extension step at 72°C for 5min.The amplification products were then parated on 6%polyacryl-amide-gel electrophoresis (PAGE)quencing gels at 85W for 1.5h after an initial pre-electro-phoresis for 30min.The gel was then removed from the apparatus and visualized by silver stain-ing (Xu et al.2002).
Amplified fragment length polymorphism (AFLP)analysis
AFLP (Vos et al.1995)was performed in con-junction with BSA analysis following the manu-facturer’s instructions for the Gibco-BRL AFLP Analysis System kit (Life Technologies,Gaithers-burg,Md.),with minor modifications (Chen et al.2004).A total of 128primer combinations were screened.The amplification products were pa-rated on a 6%PAGE quencing gel at 100W for 2h after an initial pre-electrophoresis for 30min.The gels were then silver-stained,followed by SSR analysis.
Mapping of the EP gene
Primary mapping was performed by SSR analysis combined with BSA analysis,in which the mapped
SSR markers were ud as anchor loci to map the EP gene.Following the identification of potential linkage markers,co-gregation analysis was car-ried out with the F 2population to verify the linkage of the markers to the EP gene.This method enabled the EP gene to be mapped primarily to a specific chromosome.In order to develop more markers cloly linked to the EP gene,we performed AFLP analysis together with BSA analysis in the F 2population.Using the SSR and AFLP data together with the phenotypic data,we developed a local linkage map with MAP-MAKER ver.3.0(Lander et al.1987).Recombi-nation fractions were converted into genetic map distance (centiMorgans,cM)using the Kosambi mapping function (Kosambi 1944).
Results
Obrvation of the EP-trait phenotype
The EP and CP types differed significantly with respect to phenotype.The panicles of both types remained equally erect from heading to flowering (Fig.1a);however,the panicles of the CP-type cultivar started to droop towards the end of the flowering period.The maximum amount of curv-ing in the CP-type cultivars occurred about 25days after the start of flowering,while EP-type cultivars remained erect at this time (Fig.1b,c).The leaves of the EP-type variety were greener and wider than tho of the CP type.In addition,the culm nodule of the EP type was thicker than that of CP-type cultivars,rembling that of
the
Fig.1The phenotype of the erect panicle (EP)-type parent Liaojing 5and the curved panicle (CP)-type parent Fengjin at different growth stages.a The phenotype of EP and CP plants at the flowering stage,b the phenotype of an EP plant at the mature stage,c the phenotype of a CP type plant at the mature stage
麦斜岩culm dwarf.The EP type also had more primary branches and more spikelets per primary branch than the CP type(data was not shown).
Anatomical characterization of the two phenotypes
The panicle stem was ud as experimental material to compare the anatomical structure difference between two phenotypes.Cell-wall morphology was examined by scanning electron microscopy.The EP type had more vascular bundles(Fig.2a,b)and thicker sclerenchyma cell walls at the mature stage(Fig.2c,d)than its CP counterpart;however,no difference in cell width and length were found between the two types.
Genetic analysis of the EP trait
Field tests performed once a year for two concutive years showed that all of the F1 individuals wer
e of the EP type.Table1shows the genetic analysis of the progeny of the cross Liaojing5·Fengjin.A total of6342plants from the F2population were examined over the2years of the study.Of the,4846were EP and1496were CP,whichfits a3:1ratio;this result was confirmed by v2tests(Table1),thereby indicat-ing that a dominant gene controls the EP trait.
Similar obrvations on the BC1F1population generated from the same cross over the two concutive years of the study confirmed the conclusion drawn from the F2data.Of a total of 227BC1F1plants,110were EP and117were CP. This result(P>0.05;Table1)fits the expected 1:1ratio.It is therefore safe to conclude that the EP trait is controlled by one dominant gene. This conclusion is in agreement with that reported earlier by Xu et al.(1995)bad on field statistical data.
Screening of SSR and AFLP markers linked to the EP gene and primary mapping of the EP gene
One hundred plants of the F2population derived from the cross Liaojing5·Fengjin were ud to screen for molecular markers putatively linked to the EP gene.In total,120SSR primer-pairs that were evenly distributed throughout the12chro-mosomes were lected and screened.The screened markers were further checked with100 recessive individuals of the F2population
to Fig.2Scanning electron
micrographs showing the
differences between
vascular bundles and
sclerenchyma cells in EP-
type and CP-type plants.
a,b Comparison of
vascular bundles in EP(a)
and CP(b)-type plants,c,
d comparison of
sclerenchyma cells in EP
(c)and CP(d)-type
plants
verify their linkage with the EP gene.Of the, one marker,RM242on chromosome9,showed linkage with the EP gene.Subquently,all of the SSR markersflanking RM242on the updated linkage map were analyzed,andfive markers (RM1189,RM257,RM242,RM3787and RM1013)were identified as being linked to the EP gene.The amplification pattern of RM257is shown in Fig.3.
In order tofind new markers that are more cloly linked to the EP gene,we synthesized SSR primersflanking the EP gene,bad on the GRAMENE public am-ene),and subquently analyzed their linkage relationship to the EP gene.The results indicated that four new SSR markers(RM5707-18, RM5093-5,RM5686-23and RM5833-11;Table2) were linked to the EP gene.The EP gene was located between the RM5686-23and RM5833-11 markers,with genetic distances of1.5and0.9cM, respectively.According to the physical mapping GRAMENE data,the two markers were located on bacterial artificial chromosome(BAC)acces-sions AP005686and AP005833,respectively,and the physical distance between RM5686-23and RM5833-11was about400kb.
In the AFLP-BSA analysis,about50–80bands appeared in each lane of the PAGE gel when amplified with a2+3primer-combination and visualized using silver staining(Xu et al.2002).
In Fig.3The amplification pattern of the SSR marker,
RM257,in30F2plants of the CP type generated from
the cross Liaojing5·Fengjin.The samples in each lane
are:P E,EP parent Liaojing5,P C,CP parent Fengjin,B E,
EP bulk,B C,CP bulk,1–30F2CP individuals.A3.5%在线检测电脑配置
agaro gel was ud in the electrophoresis,and the gels
were subquently stained with EtBr.Asterisks indicate
the recombinant
Table1Genetic analysis and v2scores of F2and BC1F1populations generated from the cross Liaojing
5·Fengjin Population Year Total number
of plants
Number of plants
with the erect
panicle(EP)trait
Number of plants
with the curved
panicle(CP)trait
EP/CP
吵的组词
ratio
P v2-test
F22004483436481186 3.08>0.05ns a 20051258948310 3.06>0.05ns
Total609245961496 3.07>0.05ns
BC1F1200413965740.88>0.05ns 2005884543 1.05>0.05ns
Total2271101170.94>0.05ns
a ns,Means not significantly different
Table2Newly developed SSR markers
Marker name Originated BAC/PAC a Primer quence Fragment size(bp) RM5707-9AP0057075707-9F5¢GCATCGCTTGATTAGGCT3¢240
5707-9R5¢CCCACATCCAACAGCATT3¢
RM5093-5AP0050935093-5F5¢GGACTACCAATCTTGAGTTT3¢286
5093-5R5¢ATGTCTGGTGTAAATTGAGA3¢
RM5686-23AP0056865686-23F5¢CCATTATTAGGTCGGACG3¢320
5686-23R5¢TTGGTTGTTCGGTGGAAT3¢
RM5833-11AP0058335833-11F5¢GAACCACACCAACCAACT3¢335
5833-11R5¢GATTTCTCTATGATGACTGGC3¢
a BAC,Bacterial artificial chromosome;PAC,P1-derived artificial chromosome
