RpoS and Indole Signaling Control the Virulence of Vibrio anguillarum towards Gnotobiotic Sea Bass (Dicentrarchus labrax)Larvae
Xuan Li1,Qian Yang1,Kristof Dierckens1,Debra L.Milton2,3,Tom Defoirdt1,4*
1Laboratory of Aquaculture and Artemia Reference Center,Ghent University,Ghent,Belgium,2Southern Rearch Institute,Birmingham,Alabama,United States of America,3Department of Molecular Biology,Umea˚University,Umea˚,Sweden,4Laboratory of Microbial Ecology and Technology,Ghent University,Ghent,Belgium
Abstract三国演义人物介绍
Quorum nsing,bacterial cell-to-cell communication with small signal molecules,controls the virulence of many pathogens.In contrast to other vibrios,neither the VanI/VanR acylhomorine lactone quorum nsing system,nor the three-channel quorum nsing system affects virulence of the economically important aquatic pathogen Vibrio anguillarum.
Indole is another molecule that recently gained attention as a putative signal molecule.The data prented in this study indicate that indole signaling and the alternative sigma factor RpoS have a significant impact on the virulence of V.
anguillarum.Deletion of rpoS resulted in incread expression of the indole biosynthesis gene tnaA and in incread production of indole.Both rpoS deletion and the addition of exogenous indole(50–100m M)resulted in decread biofilm formation,exopolysaccharide production(a phenotype that is required for pathogenicity)and expression of the exopolysaccharide synthesis gene wbfD.Further,indole inhibitors incread the virulence of the rpoS deletion mutant, suggesting that indole acts downstream of RpoS.Finally,in addition to the phenotypes found to be affected by indole,the rpoS deletion mutant also showed incread motility and decread nsitivity to oxidative stress.
Citation:Li X,Yang Q,Dierckens K,Milton DL,Defoirdt T(2014)RpoS and Indole Signaling Control the Virulence of Vibrio anguillarum towards Gnotobiotic Sea Bass(Dicentrarchus labrax)Larvae.PLoS ONE9(10):e111801.doi:10.1371/journal.pone.0111801
Editor:Riccardo Manganelli,University of Padova,Medical School,Italy
Received August7,2014;Accepted October7,2014;Published October31,2014
Copyright:ß2014Li et al.This is an open-access article distributed under the terms of the Creative Commons Attribution Licen,which permits unrestricted u,distribution,and reproduction in any me
dium,provided the original author and source are credited.
Data Availability:The authors confirm that all data underlying the findings are fully available without restriction.All relevant data are within the paper and its Supporting Information files.
Funding:This work was financially supported by the Scientific Rearch Fund of Flanders(FWO-Vlaanderen project n u1.5.013.12N)and the Special Rearch Fund of Ghent University(GOA project n u BOF12/GOA/022).XL and QY are doctoral rearchers funded by a China Scholarship Council grant and a Special Rearch Grant(BOF-UGent)of Ghent University.TD is a postdoctoral fellow of FWO-Vlaanderen.The funders had no role in study design,data collection and analysis,decision to publish,or preparation of the manuscript.
Competing Interests:The authors have declared that no competing interests exist.
*Email:Tom.Defoirdt@UGent.be
Introduction
Vibrio anguillarum is the causative agent of vibriosis,a fatal haemorrhagic pticaemia affecting many aquatic organisms(fish, crustaceans as well as mollusks)[1].The bacterium is a major pathoge
n of aquaculture organisms,causing significant economic loss in the aquaculture industry[2].Several(putative)virulence factors have been identified,although for many of the factors, the specific role in dia is not yet known.Three factors that have been reported to be esntial for pathogenicity include the iron uptake system involving the siderophore anguibactin[3–4], chemotactic motility(which is required for entry into the host)[5–6]and exopolysaccharide production(which is required for attachment to the host)[7].The bacterium produces a number of other(putative)virulence factors,including haemolysin,lipa and protea[8–10].However,whether or not the factors are really esntial for pathogenicity is currently not clear.
As virulence factors are often costly metabolic products,their expression usually is tightly regulated.Quorum nsing,a type of bacterial cell-to-cell communication that us small signal mole-cules,is one of the regulatory mechanisms controlling the expression of virulence genes in many bacteria[11].Vibrio anguillarum has been documented to contain two quorum nsing systems,a‘classical’acylhomorine lactone(AHL)system involving the signal syntha/receptor pair VanI/VanR,and a three-channel system as found in many vibrios[12].Unlike other vibrios,reports published to date indicate that quorum nsing is not involved in regulating the virulence of V.anguillarum[1,12] and we found that this is also the ca in gnotobiotic a bass larvae(our unpublished results).
Indole is another molecule that recently gained attention as a putative quorum-nsing signal molecule[13].Indole is produced by tryptophana(encoded by the tnaA gene),which reversibly converts tryptophan into indole,pyruvate and ammonia[14]. Despite the fact that many bacteria(including veral vibrios) have been known for a long time to produce substantial amounts of indole,its biological role as a signal molecule has only recently been revealed[13].Most work in this respect has been done on enteric bacteria,mainly E.coli,in which indole has been reported to control virulence-related phenotypes such as biofilm formation,motility,chemotaxis and adherence to epithelial cells [15–16].In enteropathogenic E.coli,the indole biosyntha TnaA,has been reported to be required for virulence to nematodes[17].Finally,indole production li is regulated by the alternative sigma factor RpoS as RpoS induces the expression of the tryptophana gene tnaA[18].Thus far,very
little is known on the role of indole in vibrios and the only report published to date documented that indole increas polysaccha-ride production,biofilm formation and grazing resistance in V. cholerae[1
9].
In the prent study,we aimed to investigate the impact of indole signaling and RpoS on the virulence of V.anguillarum in a highly controlled model system with gnotobiotic European a bass(Dicentrarchus labrax)larvae and on the production of veral important virulence factors.
Results
Impact of RpoS on indole production in V.anguillarum RpoS had previously been reported to increa indole production in E.coli by inducing the expression of the tryptophana gene tnaA[18]and conquently,we investigated the impact of rpoS deletion on indole production in V. anguillarum.In contrast to what has been reported li, indole production was significantly incread in the rpoS mutant when compared to wild-type V.anguillarum(Figure1A).The difference between the two strains in indole levels was two-fold in late exponential pha(12h)and three-fold in stationary pha (24h).In addition,we determined the relative expression levels of the indole biosynthesis gene tnaA in the wild type and rpoS deletion mutant by quantitative rever transcripta PCR,and found that the expression was significantly higher in the rpoS mutant at all sampling points,with between3-and12-fold difference between both strains(Figure1B).
Impact of RpoS and indole on the virulence of V. anguillarum towards a bass larvae
The rpoS deletion mutant showed a significantly decread virulence towards a bass larvae,with no significant difference in survival when compared to unchallenged larvae(Figure2).This indicates that RpoS plays an important role in the pathogenicity of V.anguillarum.
As the rpoS deletion mutant showed reduced virulence and incread indole production,we hypothesid that the effect of RpoS might(at least in part)be mediated by indole and conquently,we investigated whether the addition of indole
could decrea the virulence of wild-type V.anguillarum.Direct addition of indole to the a bass rearing water resulted in a significantly incread survival at50m M indole or more (Figure2).However,we noticed that indole also affected the a bass larvae since they were clearly more active in the indole treatments(especially the100m M treatment).To exclude any effect of indole on the larvae,wild-type V.anguillarum was grown in the prence of indole,and cultures were washed to remove the indole prior to inoculation into the a bass rearing water.Pretreatment with indole also resulted in a significantly decread mortality of a bass larvae challenged with wild-type V.anguillarum(Figure2),indicating that indole indeed decread the virulence of V.anguillarum.Import
antly, 100m M indole has no effect on growth of V.anguillarum, nor does it affect its survival in a water(Figure S1and Table S1).
Finally,we investigated whether the addition of the indole inhibitors isatin and acetyl-tryptophan could increa the virulence of the rpoS mutant,which would confirm that the impact of RpoS on virulence is(partly)mediated by indole signaling.Isatin has been described before to decrea the production of indole li by decreasing tnaA expression[13]whereas acetyl-tryptophan has been described as a noncompetitive inhibitor of tryptophana[33].Both inhibitors(added to the rearing water at 50m M)decread the survival of a bass larvae challenged to the rpoS mutant(Figure2),but the difference was not significant for isatin.Importantly,the inhibitors had no effect on survival of a bass larvae in the abnce of V.anguillarum.
Impact of RpoS and indole on biofilm formation and exopolysaccharide production
We subquently investigated the mechanism by which RpoS and indole affect the virulence of V.anguillarum.Biofilm formation and exopolysaccharide production are linked with each polysaccharide production contributes to biofilm formation)and are also required for pathogenicity of V. anguillarum[7].Therefore,in order to determine the mecha-nism by which indole a
nd RpoS affect the virulence of the bacterium,we investigated the impact of RpoS and indole on the two phenotypes.We found that the rpoS deletion mutant produced significantly less biofilm(in fact,the mutant hardly produced any biofilm)and exopolysaccharides than the wild type (Table1).Furthermore,the addition of indole also decread biofilm formation and exopolysaccharide production in wild-type V.anguillarum(Table1)and addition of the indole inhibitor acetyl-tryptophan incread biofilm formation and
exopolysac-Figure1.Indole production in V.anguillarum wild type(WT)and rpoS deletion mutant(D rpoS).(A)Indole production(bars)and cell density(lines)of V.anguillarum WT and D rpoS during growth in LB20 medium.(B)Relative expression of the indole biosynthesis gene tnaA in the wild type and the rpoS mutant.The expression was calculated relative to the RNA polymera A subunit(rpoA)gene,expression in the wild type at the6h time point was t at1and the other data points were normalid accordingly.For both panels,error bars reprent the standard error of three V.anguillarum cultures.**indicates a significant difference when compared to the wild type at the respective time point (independent samples t-test;P,0.01).
doi:10.1371/journal.pone.0111801.g001
charide production in both wild type and rpoS deletion mutant (Table S2).
In order to confirm the obrvations,we determined the impact of RpoS and indole on the expression of the wbfD and wza genes by quantitative rever transcripta PCR,which are responsible for exopolysaccharide biosynthesis and export in V.anguillarum ,respectively [7].The expression of the exopoly-saccharide synthesis gene wbfD was significantly lower in the rpoS deletion mutant than in the wild type at all sampling points (Figure 3A ),whereas the expression of th
行管局>保留的意思e exopolysac-charide export gene wza was higher in the rpoS mutant at all time points (Figure 3B ).Furthermore,the addition of indole (both 50and 100m M)to the wild type resulted in an over 10-fold decrea in wbfD expression,whereas there was no effect on the expression of wza.
Impact of RpoS and indole on nsitivity to oxidative stress
RpoS has been reported to affect stress nsitivity in many bacteria,including V.anguillarum [20].Therefore,we tested the impact of RpoS and indole on the resistance of V.anguillarum to reactive oxygen,which is part of the defen system of vertebrates and invertebrates.We have previously reported that the polyphe-nol compound pyrogallol inactivates vibrios by releasing peroxide,and that peroxide is neutralid by the addition of catala [21].Therefore,to asss resistance to oxidative stress,we expod V.anguillarum to pyrogallol,with and without catala.We found that the addition of pyrogallol resulted in .70%reduction of cell counts in wild-type V.anguillarum and that catala could neutrali this effect (Figure 4).The rpoS deletion mutant was more nsitive than the wild-type,with approximately
90%
月子里吃什么Figure 2.Impact of RpoS and indole signaling on the virulence of V.anguillarum towards gnotobiotic a bass larvae.Survival of gnotobiotic a bass larvae challenged with V.anguillarum wild type (WT),with or without indole (either added to the a bass rearing water or added to V.anguillarum cultures and removed prior to inoculation into the rearing water),and the rpoS deletion mutant (D rpoS ),with or without the indole inhibitors isatin and acetyl-tryptophan (both added to the rearing water at 50m M)8days after inoculation of the pathogen into the rearing water.Error bars reprent the standard error of 10fish cultures.Different letters denote significant differences (ANOVA with Tukey’s post-hoc test;P ,0.01).‘‘Control’’refers to unchallenged larvae that were otherwi treated in the same way as in all other treatments.doi:10.1371/journal.pone.0111801.g002
Table 1.Biofilm formation and exopolysaccharide production of V.anguillarum wild type (WT)and rpoS deletion mutant (D rpoS )(average 6standard error of three independent replicates).
Treatment Biofilm formation 1Exopolysaccharide production 2WT
0.2360.01a 14146178A WT +50m M Indole 0.1560.02b 1197632B WT +100m M Indole 0.1460.01b 899637C D rpoS
0.0960.01c
697670C
Different superscript letters denote significant differences (ANOVA with Tukey’s post-hoc test;P ,0.01).1
OD 571of Crystal Violet stained biofilms.2
Fluorescence intensity (excitation at 405nm,emission at 500nm)of calcofluor white stained cultures.doi:10.1371/journal.pone.0111801.t001
reduction in cell counts.Again,the effect of pyrogallol could be neutralized by the addition of catala.Finally,the addition of 100m M indole did not affect resistance to oxidative stress of wild-type V.anguillarum (data not shown).
Impact of RpoS and indole on other virulence-related phenotypes
We finally investigated the impact of RpoS and indole on the production of various virulence factors,including motility and lipa,phospholipa,caina,gelatina and hemolytic activi-ties.Of
the,only motility showed to be significantly different between wild-type and rpoS deletion mutant.Remarkably,the motility of the rpoS deletion mutant was almost two-fold higher than that of the wild-type,with motility zones of (25.060.9)mm and (52.260.7)mm for wild-type and rpoS mutant,respectively.Finally,the addition of 100m M indole to wild-type V.angu-illarum did not affect any of the phenotypes.
Discussion
In this study,we investigated the impact of indole signaling and of the alternative sigma factor RpoS on the virulence of the bacterium towards gnotobiotic a bass (Dicentrarchus labrax )larvae.We found that pre-treatment of wild-type V.anguillarum with indole before inoculation into the larval rearing water resulted in decread mortality when compared to larvae that were challenged with untreated V.anguillarum .This indicated that elevated indole levels decrea the virulence of V.anguillarum .Indole has been reported to have a positive effect on the intestinal epithelial barrier function in mice [16,22].However,as far as we know,this is the first report showing the involvement of indole in bacterial infection of a vertebrate host,thereby broadening the repertoire of phenotypes that are regulated by indole in bacteria.Furthermore,the addition of exogenous indole to wild-type V.anguillarum decread biofilm formation,exopolysaccharide levels and expression of the exopolys
accharide synthesis gene wbfD in wild type V.anguillarum ,whereas the exopolysaccharide transport gene wza was not affected.Since exopolysaccharide production and WbfD are required for pathogenicity of V.anguillarum [7],the lower exopolysaccharide production and wbfD expression might be a key factor explaining the lower virulence of V.anguillarum that has been expod to elevated indole levels.The results are opposite to what has been reported for V.cholerae ,where indole activates the expression of polysaccharide synthesis genes [19].
Becau RpoS had previously been reported to affect the production of the signaling molecule indole in E.coli ,we determined whether indole production in V.anguillarum is regulated by RpoS.In contrast to what has been reported before li ,where RpoS stimulates indole production [18],the V.anguillarum rpoS deletion mutant showed higher expression of the indole syntha tnaA than the wild-type,and approximately three-fold higher indole levels were detected in cultures of the rpoS deletion mutant when compared to wild-type cultures.As far as we know,this is the first report demonstrating regulation of indole production by RpoS in
vibrios.
Figure 3.Impact of RpoS and indole signaling on the expression of genes involved in exopolysaccharide production in V.anguillarum.Relative expression of the exopolysaccharide biosynthesis gene wbfD (A )and the exopolysaccharide export gene wza (B )in wild type V.anguillarum and the rpoS deletion mutant (D rpoS ).The expression was calculated relative to the RNA polymera A subunit (rpoA )gene,expression in the wild type at the 6h time point was t at 1and the other data points were normalid accordingly.Error bars reprent the standard error of three different V.anguillarum cultures.**denotes a significant difference when compared to the wild type strain without indole at the respective time point (independent samples t-test;P ,0.01).
doi:10.1371/journal.pone.0111801.g003
Figure 4.Impact of RpoS on stress nsitivity of V.anguillarum.Survival of V.anguillarum wild type (WT)and rpoS deletion mutant (D rpoS )after 6h incubation in a water,with or without pyrogallol (10mg l 21),and with or without catala (10mg l 21).Survival was determined by plate counting on LB 20agar.Error bars reprent the standard error of three independent experiments.**denotes a significant difference in survival of D rpoS when compared to WT (independent samples t-test;P ,0.01).doi:10.1371/journal.pone.0111801.g004
We further found that the rpoS deletion mutant was significantly less virulent than the wild-type,which is consistent with the decread virulence of wild-type V.anguillarum expod to indole levels similar to tho produced by the rpoS deletion mutant.This result is also consistent with what Ma et al.
[23]reported bad on an injection model in zebra fish,although the difference was more pronounced in our immersion challenge model.The rpoS deletion mutant was deficient in biofilm formation,and it produced lower exopolysaccharide levels and showed lower expression levels of the exopolysaccharide syntha wbfD than the wild-type,which is also consistent with what we obrved for the wild-type in the prence of elevated indole levels.Unlike what we found for elevated indole levels,the expression levels of the exopolysaccharide transport protein Wza were higher in the rpoS 过度劳累
deletion mutant than in the wild-type, the mutant was more motile than the wild-type(which is somewhat surprising as motility is also linked to virulence),and the mutant was significantly more nsitive to oxidative stress. The last obrvation is consistent with what has been reported before for V.anguillarum and various other species,as RpoS is generally known to be a key respon regulator to stress conditions in proteobacteria[20].Since the production of reactive oxygen species is one of the components of the innate immune defen of fish[24],higher nsitivity to oxidative stress might be a key factor explaining the avirulent phenotype of the rpoS deletion mutant.Finally,we found no difference between wild type and rpoS mutant in lipa,phospholipa,protea and hemolysin activities,which is in contrast to what Ma et al.[23] reported.This might reflect differences in the wild type strain (W-1vs.NB10in our study)or differences in the mutation type (inrtion vs.In-frame deletion in our study).
Together,our obrvations indicate that indole signaling and the alternative sigma factor RpoS have a significant impact on the virulence of V.anguillarum.Several of our obrvations suggest that the effect of RpoS is partly due to negative regulation of indole production.Indeed,deletion of rpoS resulted in incread expression of the indole biosynthesis gene tnaA and in incread production of indole.Both rpoS deletion and elevated indole levels resulted in decread biofilm formation and exo
polysaccharide production(a phenotype that is required for pathogenicity). Further,indole inhibitors incread the virulence of the rpoS deletion mutant,suggesting that indole acts downstream of RpoS. Finally,the phenotypes found to be affected by indole were a subt of tho affected by RpoS.Indeed,in contrast to what we found for the rpoS deletion mutant,elevated indole levels did not affect motility or nsitivity to oxidative stress.Further rearch is needed to further unravel the mechanism by which indole affects the virulence of V.by identifying the indole receptor and regulatory cascade).
Materials and Methods
Bacterial strains and culture conditions
We ud V.anguillarum strain NB10[9]and its in-frame rpoS deletion mutant AC12[25].The bacteria were cultured in LB20 medium(Luria-Bertani medium plus2%NaCl)at28u C for24h. The bacteria ud for challenge tests were grown in10%of LB20 medium with the addition of Instant Ocean artificial a salt (Aquarium Systems,Sarrebourg,France)to obtain a salinity of 36g l21on a horizontal shaker(150rpm)at16u C for48h.The density of the bacterial suspensions was determined with a spectrophotometer(Genesys20,Thermospectronic)at550nm according to the McFahrland standard(BioMe´rieux,Marcy L’Etoile,France).
Sea bass challenge tests
The disinfection of a bass eggs,hatching and axenity tests were performed according to Dierckens et al.[26]and the challenge tests were performed according to Li et al.[27].Briefly, three days after hatching,groups of12axenic larvae were stocked in vials containing10ml sterile a water.V.anguillarum strains were added to the culture water at105CFU ml21.Ten replicate fish cultures were ud per treatment.The survival of the larvae was checked2,4,6and8days after challenge.The larvae were not fed during the experiment.All the challenge experiments were approved by the ethical committee of Ghent University(no. EC2014/13and no.EC2014/59).
V.anguillarum stress nsitivity test
V.anguillarum strains were suspended at107CFU.ml21in synthetic a water(36g l21Instant Ocean),with or without pyrogallol(10mg l21;Sigma)and with or without catala from bovine liver(10mg l21;Sigma)as described previously[21].After 6h incubation at28u C,the suspensions were spread-plated on LB20agar.
Virulence factor assays
Lipa,phospholipa,caina,gelatina and hemolysin activity were assd according to Natrah et al.[28].Activity zones were corrected by colony diameter.Motility was assd as described previously[29]on LB20medium with0.3%agar.Two microliter volumes of overnight grown cultures(t at OD550=0.5) were inoculated in the middle of the soft agar plates.After
Table2.Primers ud for quantitative RT-PCR.
Gene Gene function Primer quence(59R39)
rpoA RNA polymera A F:AGATTAGCACGACACACGCA
R:AGTTACAGCACAACCTGGCA tnaA Tryptophana(biosynthesis of indole)F:ACTGCTGTGTGGCGAAAAAC
R:GCGATAGAGACAGGCTGACC wza Exopolysaccharide export F:GGCGATAGGGTCATCTTGGT
R:TGAGCACAGTCGGCGGCATT wbfD Exopolysaccharide biosynthesis F:CCTGATCCTCTAGCGATTGGTTT
R:AGATTGAGCGTGATATTGGGTGT doi:10.1371/journal.pone.0111801.t002
incubation for24h at28u C,motility halos were measured.All assays were done at least in triplicate.
Quantification of indole
V.anguillarum cultures grown in LB20medium were harvested at different time points and centrifuged at80006g for5min.The concentration of indole in the supernatants was measured by mixing500m l of supernatant with500m l of Kovac’s reagent(Sigma-Aldrich).After vortexing,the top200m l were removed and the OD571was measured.The indole concentration in each sample was determined bad on a standard curve using synthetic indole(Sigma-Aldrich).At least three different V.anguillarum cultures were sampled for each treatment at each time point.
Biofilm formation assay and quantification of exopolysaccharides
The biofilm formation assay was performed in96-well polystyrene microtiter-plates,as previously described[30]with some modifications.Overnight cultures in LB20were diluted with fresh LB20medium to OD550=0.1and inoculated into a 96-well plate(200m l per well).The plate was incubated at28u C for48hours,after which wells were washed three times with 300m l sterile physiological saline to remove all non-adherent bacteria.The remaining attached bacteria were fixed with 200m l of99%methanol per well for2hours,and the plate was emptied and left to air dry overnigh
t.Then,the plate was stained for20min with200m l of1%crystal violet per well. Excess stain was rind off by placing the plate under running tap water.After the plate was air dried,the dye bound to the adherent cells was resolubilid with200m l of95%ethanol per well.The absorbance of each well was measured at570nm. For the quantification of exopolysaccharides,a Calcofluor white staining(Sigma-Aldrich)was ud as previously described[30]. For each assay,a minimum of three different V.anguillarum cultures were ud for each treatment.The reported data are reprentative of three independent experiments. Quantitative rever transcripta PCR(qRT-PCR)
Gene expression was determined with qRT-PCR as described previously[31].V.anguillarum cultures grown in LB20medium were collected at6h,12h and24h.Three different V. anguillarum cultures were sampled for each treatment.Total RNA from culture samples was extracted using the Total RNA Isolation Kit(Promega,USA)according to the manufacturer’s instructions.The cDNA was synthesized by using RevertAid H Minus First Strand cDNA Synthesis Kit(Thermo Scientific,USA). The qRT-PCR was performed in an StepOne Real-Time PCR System thermal cycler(Applied Biosystems).Data acquisition was performed with the StepOne Software.Expression of the genes encoding tryptophana tnaA,lipoprotein(exopolysaccharide export)wza,and polysaccharides(EPS)biosynthesis wbfD was determined using the DD C T method[32]using the RN
A polymera A subunit(rpoA)gene as reference gene.Specific Primer quences are prented in Table2.
Statistics
The data were analyd using one-way ANOVA followed by Tukey’s post-hoc test or by independent samples t-tests.All statistical analys were done using the SPSS software,version19. Supporting Information
Figure S1Growth of wild type V.anguillarum in LB20 medium with and without indole.Error bars reprent the standard deviation of three V.anguillarum cultures. (DOCX)
Table S1Survival of wild type V.anguillarum after6h incubation in a water without indole and with100m M indole(average6standard deviation of three V. anguillarum cultures).
(DOCX)
Table S2Biofilm formation and exopolysaccharide production of V.anguillarum wild type(WT)and rpoS deletion mutant(D rpoS),with and without the indole inhibitor acetyl-tryptophan(average6standard error of three independent replicates).
(DOCX)
Acknowledgments
We thank the Eclorie Marine de Gravelines(Gravelines,France)for providing us with a bass eggs.
Author Contributions
Conceived and designed the experiments:XL TD.Performed the experiments:XL QY.Analyzed the data:XL QY DLM TD.Contributed reagents/materials/analysis tools:KD DLM TD.Wrote the paper:XL QY KD DLM TD.
炒小锅References
1.Frans I,Michiels CW,Bossier P,Willems KA,Lievens B,et al.(2011)Vibrio
anguillarum as a fish pathogen:virulence factors,diagnosis and prevention.
Journal of Fish Dias34:643–661.
2.Austin B,Austin AD(2012)Bacterial fish pathogens:dias of farmed and wild
fish,fifth ed.Springer,New York,NY.
3.Crosa JH(1980)A plasmid associated with virulence in the marine fish pathogen
Vibrio anguillarum specifies an iron-questering system.Nature284:566–568.
4.Stork M,Di Lorenzo M,Welch TJ,Crosa JH(2007)Transcription termination
within the iron transport-biosynthesis operon of Vibrio anguillarum requires an antin RNA.Journal of Bacteriology189:3479–3488.
5.McGee K,Horstedt P,Milton DL(1996)Identification and characterization of
additional flagellin genes from Vibrio anguillarum.Journal of Bacteriology178: 5188–5198.
6.O’Toole R,Milton DL,Wolf-Watz H(1996)Chemotactic motility is required
for invasion of the host by the fish pathogen Vibrio anguillarum.Molecular Microbiology19:625–637.
7.Croxatto A,Lauritz J,Chen C,Milton DL(2007)Vibrio anguillarum
colonization of rainbow trout integument requires a DNA locus involved in exopolysaccharide transport and biosynthesis.Environmental Microbiology9: 370–382.
8.Rock JL,Nelson DR(2006)Identification and characterization of a hemolysin
gene cluster in Vibrio anguillarum.Infection and Immunity74:2777–2786. 9.Norqvist A,Norrman B,Wolf-Watz H(1990)Identification and characterization
of a zinc metalloprotea associated with invasion by the fish pathogen Vibrio anguillarum.Infection and Immunity58:3731–3736.
10.Yang H,Chen J,Yang G,Zhang XH,Li Y(2007)Mutational analysis of the
zinc metalloprotea EmpA of Vibrio anguillarum.FEMS Microbiology Letters 267:56–63.
11.Jayaraman A,Wood TK(2008)Bacterial quorum nsing:signals,circuits,and安全标志标牌
implications for biofilms and dia.Annual Review of Biomedical Engineering 10:145–167.
12.Milton DL(2006)Quorum nsing in vibrios:complexity for diversification.
International Journal of Medical Microbiology296:61–71.
13.Lee JH,Lee J(2010)Indole as an intercellular signal in microbial communities.
FEMS Microbiology Reviews34:426–444.
14.Newton WA,Snell EE(1965)Formation and interrelationships of tryptophana
班规班约
and tryptophan synthetas in Escherichia Coli.Journal of Bacteriology89:355–364.
15.Lee J,Jayaraman A,Wood TK(2007)Indole is an inter-species biofilm signal
mediated by SdiA.BMC Microbiology7:42.
