Vaccine29 (2011) 3197–3205
Contents lists available at ScienceDirect
Vaccine
j o u r n a l h o m e p a g e:w w w.e l s e v i e r.c o m/l o c a t e/v a c c i n
没关系英语e
Development and immunogenicity of recombinant GapA+Mycoplasma gallipticum vaccine strain ts-11expressing infectious bronchitis virus-S1 glycoprotein and chicken interleukin-6
Pollob K.Shil,Anna Kanci,Glenn F.Browning,Philip F.Markham∗
Asia Pacific Centre for Animal Health,School of Veterinary Science,The University of Melbourne,Parkville,Victoria3010,Australia
a r t i c l e i n f o
Article history:
Received14November2010
Received in revid form9February2011 Accepted13February2011
Available online 24 February 2011
Keywords:
Mycoplasma gallipticum ts-11
IBV-S1
Chicken IL-6
Multivalent vaccine a b s t r a c t
Mycoplasma gallipticum(MG)is a major pathogen of poultry that caus chronic respiratory dia in chickens and infectious sinusitis in turkeys.A live attenuated vaccine,ts-11,has been ud for the control of MG in veral countries.The efficacy of this vaccine is highly do dependent and theflock antibody respon is weak.To improve the functionality of the vaccine and investigate its potential as a delivery vector for foreign antigens and immunomodulatory proteins,we developed a derivative of ts-11expressing infectious bronchitis virus-S1glycoprotein(IBV-S1)and releasing chicken interleukin-6 into the extracellular milieu(MG ts-11C3(+CS))using a transposon-bad delivery vector.Following administration of MG ts-11C3(+CS)to chickens by eye-drop,an antibody respon to MG and IBV-S1, as determined by the rapid rum agglutination test(RSA)and Western blotting,respectively,could be detected.Birds inoculated with the recombinant vaccine had significantly enhanced weight gain and were partially protected against damage by pathogenic IBV.T
he results indicate that the ChIL-6relead by MG ts-11C3(+CS)may have had a non-specific effect on growth rate.They also suggest that ts-11is a promising vaccine vector,capable of delivering heterologous protective antigens,and may also provide non-specific benefits when engineered to express immunomodulatory proteins.With some improvements in the expression system,it could be ud to induce a targeted immune respon against specific mucosal pathogens,and co-expression of veral antigens would allow development of a novel multivalent vaccine.
© 2011 Elvier Ltd. All rights rerved.
1.Introduction
Mycoplasma gallipticum(MG)is an important pathogen of poultry worldwide.It is the aetiological agent of chronic respiratory dia in chickens and infectious sinusitis in turkeys and can cau vere loss in poultry enterpris[1,2].The chronic respiratory dia it caus is characterid by exfoliation of ciliated epithelial cells,accumulation of inflammatory exudates in the trachea,and a vere inflammatory respon in the air sacs[3].Antibiotics have proven ineffective in clearing MG infections[4],and current con-trol practices u inten biocurity and rological monitoring of flocks[4,5].Regulatory measures have been largely successful at minimising MG outbreaks in broiler
and turkey industries,primar-ily due to their“all-in,all-out”production cycle.However,within the layer industry eradication of infectedflocks is usually not fea-sible[6].To address this,live attenuated MG vaccines have been developed as an alternative approach to control[7].
∗Corresponding author.Tel.:+61383447422;fax:+61383447374.
E-mail address:pmarkham@unimelb.edu.au(P.F.Markham).
The MG vaccine strain ts-11is a temperature nsitive mutant generated by chemical mutagenesis of a moderately virulent Aus-tralianfield isolate(strain80083).It grows normally at33◦C but has reduced growth at39.5◦C,and a single do by eye-drop appli-cation results in colonisation of the upper respiratory tract and induction of long-term immunity[8,9].However,the efficacy of this vaccine is highly do dependent[10]and rological mon-itoring of vaccinatedflocks has been difficult becau of the low level of antibodies induced in some vaccinatedflocks[11].
Studies of gene expression in mycoplasmas have been difficult mainly becau of the lack of understanding of gene regulatory ele-ments and uncertainty in identifying promoter quences.Thefirst foreign gene to be functionally expresd in a mycoplasma was the-galactosida(lac Z)gene of Escherichia coli.The lac Z gene was ud as a reporter gene in mollicut
es in experiments with Acholeplasma oculi[12]and M.gallipticum using a transposon Tn4001derivative(Tn4001lac)within the plasmid pISM2062lac. This derivative had a promoterless lac Z gene inrted into one of the IS256elements[13].The expression of lac Z has also been tested under the control of various mollicute promoters in M.gallipticum [14],Mycoplasma pulmonis[15]and M.capricolum[16].
0264-410X/$–e front matter© 2011 Elvier Ltd. All rights rerved. doi:10.1016/j.vaccine.2011.02.035
3198P.K.Shil et al./Vaccine29 (2011) 3197–3205
Infectious bronchitis virus(IBV)is a member of the family Coronaviridae.The virion is enveloped,with club-shaped surface projections(spikes)[17].The spike glycoprotein(approximately 1145amino acids in length)consists of the amino terminal S1 (approximately520amino acid residues)and carboxyl terminal S2(approximately625amino acid residues),which are gener-ated by post-translational cleavage.S1and S2associate to form the viral envelope,in which S1is expod on the virion surface, anchored by S2[18].The S1subunit induces neutralising,rotype-specific and haemagglutination-inhibiting antibodies[19].Thus the best candidate gene for inclusion in a recombinant vec-tor to protect against IBV would em to be the one encoding S1.
Cytokines play an important role in the functional diversity of immune respons.Interleukin-6(IL-6)is a multifunc-tional cytokine produced by T and B lymphocytes,mono-cytes/macrophages and endothelial cells,and has been found to be potent in promoting systemic and mucosal immunity when co-administered with protein antigens by improving Th2respons [20].Additionally,it is involved in the initial activation of T lymphocytes[21]and is able to switch the differentiation of dendritic cells to macrophages[22]and to induce an acute pha respon.Thus the gene encoding chicken IL-6would em to be an appropriate choice for expression as an adju-vant.
For successful colonisation of the respiratory tract MG mustfirst establish a specific andfirm attachment to its target cell to avoid rapid clearance by innate host defence mechanisms[23].GapA,a 105kDa protein,is considered the primary cytadhesin molecule in MG.Studies have found that GapA and CrmA co-expression is esntial for MG cytadherence and virulence[24].Abnce of GapA but not CrmA has been obrved in the MG vaccine strain,ts-11 [25],and the expression of CrmA is not dependent on expression of GapA[26].
In this study,we developed a transposon-bad vector construct that enabled the expression and relea of a foreign protein in MG and ud this to develop strains of GapA+MG ts-11that expresd the IBV-S1glycoprotein with ChIL-6either fud to the S1protein or creted from the bacterial cell.W
e examined the capacity of the recombinants to generate protective immunity in the respiratory tract of chickens.
2.Materials and methods
2.1.Mycoplasma gallipticum strain and culture
The GapA+MG ts-11strain was ud in this study.This strain was originally isolated from a MG ts-11working ed culture and lected for expression of GapA by plating the cul-ture,picking single colonies and examining them by PCR and immunoblotting using specific antira against GapA[26].Cul-ture of the organism was performed in mycoplasma broth(MB) (7.5g tryptica peptone,2.5g phytone peptone,0.5g thiotone peptone,5g yeast extract,0.25g benzyl penicillin,5g NaCl,0.4g KCl,0.35g MgSO4·7H2O,0.05g Na2HPO4,0.1g KH2PO4,1g glu-co,1.5ml1.6%phenol red solution,100ml inactivated swine rum,10ml1%nicotinamide adenine dinucleotide solution,10ml 0.2%DNA solution,10ml yeast autohydrolysate,1.5ml10%thal-lium acetate solution,800ml distilled water,pH adjusted to8.1) or by plating on mycoplasma agar(MA),which has the same composition as MB except that gluco and phenol red were omitted and the medium was solidified with1%agar(Oxoid). For the lection of MG transformants,gentamicin(Invitrogen) was added to the liquid or solid medium to a concentration of 160g/ml.2.2.Plasmid construction
The primers ud for construction are shown in Table1.A frag-ment of the S1gene of IBV vaccine strain Vic S(nt891–1688,798bp) was amplified from a plasmid and cloned into pGEM-T(Promega). The amplified S1gene fragment was located towards the carboxyl terminus of S1and included one of the three main neutralising epitopes[27].The S1fragment was then relead from pGEM-T-S1by digestion with the restriction endonucleas Bam HI and Hin dIII and subcloned in similarly digested pGEM-T carrying the MG ltuf promoter,signal li alkaline phosphata gene (phoA)fud with or without the cleavage signal(KQASETQ)for MG VlhA1.9[28]and a MG codon-optimid chicken IL-6gene(ChIL-6) (Genbank accession number AJ309540),generating pGEM-T-ltufP-sig-S1-ChIL-6with(+CS)or without(−CS)the cleavage signal.The ltufP-sig-S1-ChIL-6fragment with or without the cleavage signal was then excid in total using Not I and Bgl II and inrted into the transposon Tn4001in Not I and Bam HI digested pISM2062.2lac [13]to generate pISM-ltufP-sig-S1-ChIL-6(+CS)and pISM-ltufP-sig-S1-ChIL-6(−CS).The resulting plasmids were ud for the transformation of MG.The DNA quence of the construct was con-firmed by quencing using the ABI PRISM Big Dye Terminator kit (Applied Biosystems)following the manufacturer’s instructions.
2.3.Transformation of M.gallipticum
Transformation of MG was performed by electroporation. Briefly,GapA+MG ts-11was cultured overni
ght and the growth of the cells determined by colour change of the phenol red indica-tor.Cells were collected by centrifugation at13,000×g for5min in a benchtop centrifuge.The cells were washed two times in cold HEPES sucro buffer(8mM HEPES,272mM sucro,pH7.4)and resuspended in the same buffer with10g of plasmid DNA result-ing in a ratio of plasmid DNA to cells of40:1.The cell-plasmid mixture was transferred to a pre-chilled electroporation cuvette (0.2cm,Bio-Rad)and immediately puld(2.5kV,100 and25F) using a Gene Pulr(Bio-Rad).The electroporated cells were resus-pended immediately in1ml of cold MB and incubated on ice for 10min,followed by incubation at33◦C for2–3h,depending on the extent of colour change.The cells were then plated onto MA con-taining160g gentamicin/ml and incubated at33◦C in an airtight bag for7–10days.
2.4.Expression and purification of glutathione-S-transfera (GST)fusion proteins
The ChIL-6or S1gene fragments were cloned into the Bam HI cleavage site of the expression vector pGEX-4T-1(Amersham Bio-sciences).The induction of expression and affinity purification of fusion proteins were performed following the manufacturer’s instructions.Briefly,li hosts BL-21(for ChIL-6expres-sion)or JM109(for S1expression)were ud for the cloning of recombinant plasmids.Transformants were lected on LB plates containing100g ampicillin/ml.Log pha cultures(approximate OD of0.5–2.0)were induced at30◦C(for ChIL-6)or37◦C(for S1) for4h by adding I
PTG to afinal concentration of1mM.The cells were collected by centrifugation,then lyd,recombinant proteins purified by affinity column chromatography and equal amounts of proteins then analyd by SDS–PAGE.The parated proteins were transferred electrophoretically onto a membrane.Western blotting was performed with anti-GST-HRP conjugated antibody (GE Healthcare),mou anti-chicken IL-6monoclonal antibody (kindly provided by Dr.Hyun S.Lillehoj,USDA-ARS Laboratory,MD, United States)and rabbit anti-GST-S1polyclonal antibody(gift of Dr.Chien-Ju Chiu).
P.K.Shil et al./Vaccine29 (2011) 3197–32053199
考研政治真题下载Table1
Primers ud in this study.
Primer name Sequence(5 –3 )PCR conditions Product size(bp)Reference MG16SrRNAFor GAGCTAATCTGTAAATTGGTC
94◦C3min and35cycles of94◦C30s,55◦C30s,72◦C60s
MG16SrRNARev GCTTCCTTGCGGTTAGCAAC183[45] GentFor CCAAGAGCAATAAGGGCATAC
95◦C2min,28cycles of95◦C30s,60◦C30s,72◦C15s and72◦C5min
GentRev ACACTATCATAACCACTACCG223This study IBVS1ForNew CAGGCCAAGGTCTTATTACT
94◦C3min,30cycles of94◦C30s,50◦C30s,72◦C45s and72◦C5min
IL6RevNew GCTCCAGCTTCTTCTTCTAAACC413or392a This study GapAFor AGATAAATTCACTCAAGAAAATAAT
94◦C5min and40cycles of94◦C15s,53◦C30s,72◦C15s
GapARev TGTTAATCATGTGCTGTCTTT120or100b[26]
a413bp with cleavage quence or392bp without cleavage quence.
b Expected size for ts-11:120bp for GapA−,100bp for GapA+.
2.5.Characterisation of M.gallipticum transformants
Colonies of putative gentamicin-resistant transformants were lected randomly from agar plates an
d inoculated into500l of fresh MB containing gentamicin.Following growth(judged by a change in colour of the medium)at33◦C,the clones were further sub-cultured a few times and then stored at−70◦C.Cells in a1ml volume of culture were pelleted by centrifugation at13,000×g for 5min at room temperature,the cell pellet re-suspended in50l of water,heated at95◦C for5min and0.5l ud as template in a PCR to verify the prence of the gene construct.The oligonu-cleotide primers ud to determine the prence of the gentamicin gene,deletion of the cleavage signal and a20bp inrtion in the gapA gene found in ts-11are shown in Table1.PCR was performed in a total volume of25l using GoTaq polymera(Promega)as described by the manufacturer.The PCR conditions and the sizes of the products are shown in Table1.Expression of S1and chicken IL-6 were assd using anti-GST-S1and anti-chicken IL-6antibodies to detect the proteins in Western blots.
The culture supernatants of the transformants were collected and screened for ChIL-6relea using a murine hybridoma cell line 7TD1bioassay as described previously[29].Briefly,the7TD1cells (kindly provided by Garry Barcham,Centre for Animal Biotech-nology,the University of Melbourne,Australia)were passaged in six well Nunclon TM plates(Nunc)containing5ml of Dul-becco’s Modified Eagle’s Medium(DMEM)(GIBCO)and1ng of recombinant human IL-6(rHuIL-6)(GenWay Biotech)per ml of media.The cells were passaged once every2–3days to main-tain a maxi
mum titre of log pha cells.Four days prior to the assay,the cell cultures were expanded in a75cm2tissue culture flask(Becton Dickinson)containing30ml of DMEM,1ml of log pha cells and30ng of rHuIL-6.Following48h of growth,the medium was removed from the cells by washing three times in PBS.The cells were then re-eded in30ml of DMEM without IL-6.After starvation for2days,a cell viability count was car-ried out using trypan blue staining and viable cells were diluted to2×104cells/ml.Ninety-six well Nunclon TM plates were t up with varying amounts of supernatants from cultures of the transformants as sources of ChIL-6.All samples were assayed in triplicate and appropriate positive(rHuIL-6),negative(GapA+ MG ts-11culture supernatant)and media controls included.The starved cells(100l)were added to each well and the plates incubated at37◦C for48h in a humidified environment with5% CO2.Cell growth was determined using a3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide(MTT)-bad cell growth determination kit(Sigma–Aldrich)following the manufacturer’s instructions.
A clone positive for ChIL-6cretion(MG ts-11C3(+CS))and one positive for expression of fud S1and ChIL-6(MG ts-11C2(−CS)) were ud to inoculate chickens to asss immune respons to them.Both the transformants were screened for the expression of GapA using anti-GapA antibody.2.6.Immunogenicity of ts-11C3and C2in chickens
Four groups of4-week-old specific-pathogen-free chickens were randomly lected and houd parately(40chickens per group)in positive pressurefibreglass isolators.At day0,chickens were inoculated by eye-drop with30l of MB(Group1),30l of broth containing9.2×106CCU of parental GapA+MG ts-11/ml (Group2),30l of broth containing6.3×108CCU of MG ts-11C3 (+CS)/ml(Group3)or30l of broth containing1.9×108CCU of MG ts-11C2(−CS)/ml(Group4).Three weeks after inoculation, 10birds from each of the groups were euthanad and necropsied. Fifteen of the remaining birds were challenged by eye-drop inoc-ulation of30l of allantoicfluid containing105median embryo infective dos of IBV strain N2-75and houd in a parate isola-tor.The remaining15birds(vaccinated but unchallenged)in each group(Groups5,6,7and8)were kept for5weeks after vaccina-tion.At day14and15after challenge,birds from Groups5and6or from Groups1–4,7and8were euthanad and necropsied.
Blood was collected weekly and examined for systemic anti-body respons against MG using the rapid rum agglutination test(RSA),with reactions scored on a scale of0–4,as described pre-viously[30].The body weight of each bird was determined before immunisation and at post-mortem.The six air sacs were visually assd for lesions and scored from0to3,as described previously [31].Re-isolation of MG was attempted from swabs taken from the upper trachea and from
the air sacs.Strain identity was confirmed by PCR.IBV-S1specific antibody was detected by Western blotting.
2.7.Measurement of tracheal mucosal thickness
Samples of the upper,middle and lower trachea were collected andfixed in10%neutral buffered formalin,embedded in paraffin, 2m ctions cut and the stained with haematoxylin and eosin. The mean mucosal thickness of the upper,middle and lower tra-chea of each bird were determined by measuring the thickness at 4points trancted by vertical and horizontal lines[31].
2.8.Asssment of tracheal B lymphocyte populations following vaccination
slackwareTracheal B lymphocyte populations were investigated by immunohistochemical staining with antibodies against a B cell marker(Bu-1).Transver ctions of the upper,middle and lower trachea were collected from randomly lected9-week-old birds (5weeks after vaccination),placed in Tissue-Tek®O.bed-ding compound(Sakura)and immediately frozen in liquid nitrogen. Frozen5m ctions were cut,stored at−70◦C and later stained as described previously[32].Monoclonal antibody specific for the B cell antigen Bu-1(mou anti-chicken-Bu-1,Southern Biotech-nology)was ud at a dilution of1/100.HRP-conjugated sheep anti-mou immunoglobulin G(Chemicon)was ud at a dilut
ion of1/100.Bound antibody was detected with3,3 -diaminobenzidine
3200P.K.Shil et al./Vaccine29 (2011) 3197–3205
Table2
ChIL-6relea into the culture supernatant of MG ts-11transformants.
Type of proliferation inducer added Optical density at
description450nm
MG ts-11C3(+CS)culture supernatant0.55±0.07a
MG ts-11C2(−CS)culture supernatant0.32±0.07b
Parental MG ts-11culture supernatant0.29±0.07b
小孩子早期教育Media control0.27±0.05b
rchIL6(200pg/ml)0.84±0.15c
ChIL-6activity determined by7TD1bioassay as described in the text.
poro
Values with the same superscript in the same column are not significantly different (P>0.05).
(DAB)(Sigma–Aldrich).Cells were counterstained with Mayer’s haematoxylin(Sigma–Aldrich).Spleen ctions were stained as positive controls.Each tracheal ction was examined microscop-ically and the number of clusters of positively stained cells was recorded[33].The area of stained cells in each of the B cell clusters was analyd in photomicrographs using Image-Pro Plus(Media Cybernetics).
2.9.Statistical analys
The mean daily weight gains for each group were analyd for differences using a one-way analysis of variance(ANOVA)and Stu-dent’s t-test(Minitab v15for Windows).Median RSA scores and air sac lesion scores were compared using Mann-Whitney U tests. Mean mucosal thickness in the upper,middle and lower trachea were compared using Student’s t-tests and a one-way ANOVA.The mean number of clusters of Bu-1positive cells perfield-of-view and the mean cross-ctional area of B cells in each cluster in the tracheal mucosa were compared between groups using Student’s t-test.P values less than or equal to0.05were regarded as signifi-cant.
3.Results
3.1.Development and characterisation of MG ts-11C3(+CS)and MG ts-11C2(−CS)
The prence of gentamicin resistance genes,the prence or abnce of the cleavage signal quence,and the abnce of a20bp inrtion in the gapA gene were confirmed by PCR,and expression of S1,ChIL-6and GapA were detected by Western blotting(results not shown).Although the prence of ChIL-6in the culture supernatant of the recombinant MG ts-11C3(+CS)was unable to be detected by Western blotting,relea of ChIL-6into the culture supernatant was detectable using the7TD1bioassay and the MTT-bad cell growth determination kit(Sigma–Aldrich)at a concentrations of approximately100pg/ml(Table2).Similar results were obtained when the experiment was repeated at least twice.
3.2.Systemic antibody respons
Table3shows the RSA scores of chickens at2,3and5weeks after vaccination.No antibodies against MG were detected in the rum of any bird at the time of vaccination.None of the unvaccinated and unchallenged chickens(Groups1and5)had any detectable anti-body against MG at post-mortem,while83%of the birds vaccinated with GapA+MG ts-11were positive by3weeks(Group2)and94% were positive by5weeks after vaccination(Group6).In the Groups vaccina
ted with MG ts-11C3(+CS),15%of the birds were positive by3weeks(Group3)and33%by5weeks after vaccination(Group
7).In tho vaccinated with MG ts-11C2(−CS),8%of the birds had
a detectable RSA respon by3weeks after vaccination(Group4) and13%had detectable RSA respon by5weeks after vaccination (Group8).All the birds in Group2,which were vaccinated with GapA+MG ts-11and challenged with IBV strain N2-75,were pos-itive by RSA.In Groups3and4,which were inoculated with the recombinant vaccines and challenged with IBV strain N2-75,47% and36%of the birds,respectively,were RSA positive at necropsy.
Western blots of affinity purified GST-S1protein were immunostained with ra collected from the birds5weeks after vaccination.An antibody respon was detected to a protein of same molecular weight as GST-S1(Fig.1)by the ra of4/15and 5/15birds vaccinated with MG ts-11C2(−CS)and MG ts-11C3 (+CS)respectively,while the ra collected from the birds vac-cinated with parental GapA+MG ts-11or inoculated with MG medium showed no reaction.Western blots of purifili expresd GST was probed with the same ra to determine whether this respon was to the S1or GST regions of the protein. Only two of the birds had a detectable respon to GST(results not shown).
3.3.Weight gain of chickens
The daily weight gains at3and5weeks after vaccination are shown in Table4.There was a significant difference in weight gain between Group2(vaccinated with GapA+MG ts-11)and Group3 (vaccinated with MG ts-11C3(+CS))at the3rd week after vac-cination(P=0.04).The birds in Group5(mock-vaccinated)had significantly lower weight gain than the birds in Groups6(vac-cinated with GapA+MG ts-11)(P=0.01)and7(vaccinated with MG ts-11C3(+CS))(P=0.001).The birds in Group3(vaccinated with MG ts-11C3(+CS))had significantly higher weight gain than the birds in Group4(MG ts-11C2(−CS))by the3rd week after vacci-nation(P=0.04)and the5th week after vaccination(Groups7and 8)(P=0.004).
Two weeks after challenge,the birds in Group3(vaccinated with MG ts-11C3(+CS))had significantly greater weight gains than the birds in Group2(vaccinated with GapA+MG ts-11)(P=0.01).
3.4.Air sac lesion scores
No lesions were en in any of the vaccinated,unchallenged birds at the3rd and5th week after vaccination.Among the chal-lenged groups,air sac lesions were en in5/15birds in Group1 (mock-vaccinated),with total air sac lesion scores ranging from0.5 to2.Air sac lesions were also en in4/14
birds in Group2(vac-cinated with GapA+MG ts-11),2/15birds in Group3(vaccinated with MG ts-11C3(+CS))and2/14birds in Group4(MG ts-11C2 (−CS)).There was no significant difference between the groups.The results are summarid in Table5.
3.5.Re-isolation of M.gallipticum
The re-isolation results are shown in Table6.MG was frequently isolated from tracheal swabs,but not from the air sacs.Broth cul-tures showing a colour change indicative of mycoplasma growth were confirmed by PCR.Swabs from the groups that had been vac-cinated and challenged with IBV strain N2-75yielded cultivable MG on MA plates,with one bird in Group1(mock-vaccinated)and one in Group2(vaccinated with GapA+MG ts-11)yielding positive cultures.In Groups3(vaccinated with MG ts-11C3(+CS))and4 (vaccinated with MG ts-11C2(−CS)),MG was recovered from2 birds from each of the groups on MA plates.PCRs for MG on broth cultures were positive for2,5,4and3birds from Groups1,2,3and 4,respectively.Broth culture of tracheal swabs from Group1were further tested using a strain differentiating PCR,which revealed that the mycoplasmas re-isolated were the recombinant MG ts-11 C3(+CS)strain.
P.K.Shil et al./Vaccine29 (2011) 3197–32053201
Table3
Rapid rum agglutination(RSA)test results.
Group Inoculated可供出售金融资产
with Challenge with
IBV N2-75at
day21
Week2Week3†Week5
%RSA+(N)*RSA Score
Median(range)
%RSA+(N)*RSA Score
Median(range)
%RSA+(N)*RSA Score
Median(range)
1MG medium+0(40)–0(40)–0(15)–
2GapA+MG
ts-11
+68(40)2(0–4)a83(40)3(0–4)a100(14)4(2–4)a
3MG ts-11C3
(+CS)
+8(40)0(0–2)b15(40)0(0–4)b47(15)0(0–4)b
4MG ts-11C2
(−CS)
+0(39)–8(39)0(0–4)b36(14)0(0–4)b
5MG medium−At the end of the3rd week,the birds were parated from
Groups1,2,3and4and kept as unchallenged controls
0(15)–
6GapA+MG
电影杯酒人生ts-11
−94(16)3(0–4)aalbee
7MG ts-11C3
(+CS)
−33(15)0(0–4)b
8MG ts-11C2vegas
(−CS)
−13(15)0(0–4)b
Values with the same superscript in the same column are not significantly different(P>0.05).
*Total number of chickens in each group is shown in parenthes,note of the30birds vaccinated with GapA+MG ts-11,16were left unchallenged(Group6)and14birds were challenged with IBV N2-75(Group2).One bird from Group4died before the end of week2.
†At the end of the3rd week,10birds from Groups1,2,3and4were euthanad and necropsied.
Table4
Weight gains of chickens.
Group Inoculated with Challenge with
IBV N2-75
Weight(g)Daily Weight gain(g)
Week0Week3Week5
1MG medium+247.28±31a14.47±2.86a,b,d13.87±2.94a,b,c 2GapA+MG ts-11+239.13±28a13.26±2.96b,c12.88±1.86b
3MG ts-11C3(+CS)+247.5±30a15.70±2.81d15.27±3.19a,c,e 4MG ts-11C2(−CS)+239.05±27a14.35±2.01a,d14.35±2.01a,c
5MG medium−At the end of the3rd week,the birds were
parated from Groups1,2,3and4and kept as
unchallenged controls
14.46±2.50c
6GapA+MG ts-11−16.36±2.13d,e
7MG ts-11C3(+CS)−17.20±2.59d
8MG ts-11C2(−CS)−14.55±2.60c Values with the same superscript in the same column are not signi
ficantly different(P>0.05).
Fig.1.Western blot analysis of purified GST-S1.Affinity purified GST-S1protein was subjected to SDS–PAGE and Western transferred.Individual strips of the blot were incubated with ra obtained from chickens5weeks after inoculation and kept as unchallenged:Lanes1–4,ra from birds vaccinat
ed with MG ts-11C2(−CS);Lanes5–8 and11,ra from birds vaccinated with MG ts-11C3(+CS);Lane9,rum from bird vaccinated with parental GapA+MG ts-11;Lane10,rum from bird inoculated with MG medium;Lane12,probed with monoclonal antibody to GST;Lane13,probed with polyclonal antibody to GST-S1.MW,broad range protein markers(New England Biolabs).
