Oil Crop Science 1 (2016) 38 -44石碳酸
An efficient method to extract DNA from refined rapeed oil Lin SHAO1’25，Yunjing LI1’25，Danfeng WAN1’2, Yuhua WU1’2, Jun LI1’2, Li ZHU1’2, Gang WU1’2**
1. Key Laboratory of Biology and Genetic Improvement of Oil Crops of the Ministry of Agriculture, Oil Crops Rearch Institute, Chine Academy of A gricultural Sciences, No.2 Xudong 2nd Road, Wuhan 430062, P. R. China
2. Supervision and Test Center( Wuhan) for Environmental Safety of Genetically Modified Plants, Ministry of A griculture, No. 2 Xudong 2nd Road, Wuhan 430062, P. R. China
Abstract ：Genetically modified oileds were ud as processing raw material for edible oils. The protection of consumer rights to information as well as the genetically modified orgamisms (GMO) labeling polily required analytical methods to determine whether the oils contained genetically modified ingredient or not. Polymera chain reaction (PCR) - bad method was ud commonly to determine the prence of GMOs. Adulteration attracted peoples concern also. Thus it was crucial that enough DNA extracts can be obtained successfully from oil samples. For the purpo, three DNA extraction methods (modified emulsification method, the kits Wizard® Magnetic DNA purification system for food
and Nucle- ospin® Food) ,were applied to 3 different grades of rapeed oil samples. Tho methods were compared by the amplification of Brassica napus reference gene CruA using real - time PCR. The results demonstrated that both the modified emulsification and the Nucleospin methods were able to extract enough DNA from refined oils. The modified emulsification method was superior to the kit of Nucleospin® food due to smaller volume of required sample.
Key words：rapeed oil,genetically modified organisms; DNA extraction；real-time PCR
1. Introduction
Edible oils have been esntial part of human life for centuries, which have widely ud in frying, baking, and other types of cooking. Also, edible oils were naturally rich in fatty acids, such as linoleic acid, and the fat - soluble vitamins A, D, E and K, which were esntial for health and may contribute to prevention of some kind of dias( Costa et al. , 2012) .The commercial edible oils included soybean oil, maize oil, sunflower oil, peanut oil, same oil, rapeed oil, olive oil and a variety of blended oils (He et a l., 2013).
wotuToday, more and more people concerned about food quality and safety. Food authenticity and traceability had become very important to help consumers to understand the details of their foods. E
dible oil safety is an important part of food safety. Two issues are concerned ：one is the prevention of fraud that expensive oil adulterated with addition of cheaper oils or over - declaring a quantitative ingredient the other is the labeling of genetically modified organisms ( GMOs ) .The adulteration of edible oils was a kind of economical fraud and implied dishonest competition between producers ,and also breached the consumersr rights and interests (Arvanitoyannis &Vlachos, 2007; Zhang et al. ,2009) .Genetically modified soybean, maize, and rapeed had been widely cultivated and commercialized (Kamle & Ali, 2013) , whether the edible oils on the market containing transgenic ingredients have become a public concern. The government had established legal basis for labeling genetically modified food, thus labeling the genetically modified raw material also become an important issue.
§ The authors contributed equally to this work. * Corresponding author. Email ： wugang@ caas. cn
Shao et al. /Oil Crop Science 1 (2016)38 -4439
Given the importance of food authenticity and traceability, some analytical technologies had been developed .For example, the techniques bad on chromatographic and spectroscopic analysis, had
been developed (Aparicio &Aparicio - Ruiz, 2000 ；Casale et al. ,2008; Ruiz - Samblat al. ,2015). In the past few years, the method bad on the analysis of DNA had gained more and more attention ( Debode et a l., 2012；Nikolic et al. , 2014). The DNA methods mainly relied on the polymera chain reaction (PCR).DNA analys had veral advantages, more nsitive, more reliable, and more effective. Several substances on the crude oil caud undesirable color, taste and aroma, which limited their application. The crude oil went through a complex process before it was considered suitable for daily dietary, thus refined oils contained little amount of DNA (Costa et al. , 2012). The efficiency of DNA extraction played an important role in the detection of DNA extracted from edible oils. Methods had been developed for DNA extraction from edible oils. The CTAB - bad protocol, the Wizard® Magnetic DNA Purification for Food kits, the Nucle- ospin® Food kits and other methods had been successfully applied in the DNA extraction of veral edible oils, mainly crude and unrefined oil ( Costa et a l., 2010a；Costa et al. , 2010b；He et al. , 2013).
Rapeed oil was one of the main consumption oil in China. According to the processing steps, the refined rapeed oils had been divided into pressing rapeeds oil and solvent extraction rapeeds oil. According to color, aroma, transparency, moisture and other physical properties, the commercial refined rape- ed oil had been classified into the fourth grade oil, the third grade oil and the first gra
de oil. The first grade oil was more fully refined than the fourth grade oil and the third grade oil. The reported DNA extraction methods mainly focud on olive oil or soybean oil, and few was about rapeed oil.
The aim of this study was to optimize DNA extraction methods for refined rapeed oil. In this study, we focud on efficiency of DNA extraction from different grade rapeed oil using three different DNA extraction methods. In additon, the optimized DNA extraction methods were evaluated by real - time PCR using Brassica na-pus reference gene CruA.This could provide technical reference for food authenticity and GMO labeling.
2. Materials and methods
2.1 Materials
9 different rapeed oils were bought from local markets in Wuhan, Hubei Province and the Jingdong online supermarket. The detailed information was shown in Table 1.
Table 1
Rapeed oil ud in this study
Sample number Grade Processing technology Producing area Brand
1Fourth Pressing Laohekou, Hubei Aoxing
2Fourth Pressing Chengdu, Sichuan Xiancan
3Fourth Pressing Nanchang, Jiangxi Hongruimen 4Fourth Pressing Wuhan, Hubei Jinlongyuj开头的女英文名
5Third Pressing Xiangyang, Hubei Luhua
6Third Solvent extration Wuhan, Hubei Jinlongyu
7Third Pressing Wuhan, Hubei Zhongyou
8First Pressing Hulunbeir, Inner Mongolia Hengdaxingan 9First Solvent extration Wuhan, Hubei Jinlongyu
2.2 DNA extraction
摒弃前嫌9 different edible oils were extracted with 3 different methods in 2 parallels and 2 duplicates.energy star
2.2.1 Modified emulsification method
same girl
Modified emulsification method was bad on the protocols described by Zhang with some modification (Zhang et al. , 2009) .50 ml of n - hexane was added to 50 ml of oil, and the mixed sample was uniformly suspended with an electromagnetic stirrer for 4 h. Then, 50 ml of 1.5 x CTAB (1.05 M NaCl, 75 mM tris-H Cl, 15 mM EDTA, 1.5% CTAB) plus 80 jxg
40Shao et al. /Oil Crop Science 1 (2016)38 -44
of salmon sperm DNA ( Sigma - Aldrich, St. Louis, MO) was added, and the stirring process was continued for another 3 h. Then the sample was centrifuged at 12000 g for 15 min. The lower pha was transferred into two new 50 ml centrifuge tube, and an equal volume of isopropanol was added, together with a 1/10 volume of 3 M sodium acetate. The solution was mixed well and placed at -20°C overnight. The solution was then centrifuged at 12000 g for 25 min at 4 °C , the supernatant was discarded, and the precipitate was dissolved in 600 (xl of 0. 1 M TE (1 mM Tris - HC1, pH 8.0, 0. 1 mM EDTA, pH 8. 0) and transferred into a new 2 ml tube. An equal volume of chloroform/isoamyl alcohol (24: 1) was then added. The sample was mixed well and centrifuged at 12000 贫 for 10 min. The supernatant was pipetted into a new 2 ml tube, and an equal volume of isopropanol was added, together with a 1/10 volume of 3 M sodium acetate and 1/100 volume of Dr. GenTLE® Precipitation Carrier ( TaKaRa, Shiga ,Japan) .The sample was well mixed and incubated at -20 °C for 2 h. The sa
mple was then centrifuged at 12000 g for 25 min at 4°C , the supernatant was discarded, and the precipitate was soaked in 600 (xl of 75% ethanol. Centrifugation was carried out once more at 12000 g for 2 min, the supernatant was carefully pipetted off, and the precipitate was dried at room temperature and dissolved in 50 jjl I of 0. 1 x TE solution. 2.2.2 Wizard Magnetic method
The Wizard® Magnetic DNA purification system for food (Promega, Madison, WI, USA) was specifically chon due to its referred application for the extraction of DNA from oil matrices ( Costa et a l., 2010a) .This method was performed according to the manufacture instructions. 160 ml oil was weighed to four 50 ml sterile falcon tube. To each tube, 2 ml of lysis buffer A was added followed by vigorous stirring.
1 ml of lysis buffer B was added and followed by vigorous stirring. After 10 min incubation with occasional mixing, 3 ml of precipitation solution was added and stirred energetically for 1 min. The mixtures were centrifuged at 4000 g for 25 min. The top layer ( organic pha) was discarded carefully, and the lower aqueous phas of the four tubes were collected to a new sterile falcon tube. To the collected volume, 50 (xl of Magne-Sil® Paramagnetic Particles was added, followed by mixing and by addition of 0. 9 volume parts of isopropanol. The mixture was homogenid by inversion and incubated for 1 h with occasional mixing. After this time, the tube was placed in a PolyATtract® Syste
m 1000 Magnetic Separation Stand support for about
2 min, until all the particles were attracted to the support. The clear solution was discharged carefully, and the particles were washed with 1. 5 ml ethanol 70% (V/V)at - 20 °C.The particles were transferred to a 2 ml sterile reaction tube and washed three more times with 1.5 ml of 70% ethanol. After careful removal of ethanol solution, the particles were dried in the uncapped tube for 15-20min. The DNA was relead from the magnetic particles with the addition of 50(j l L of 0. 1 X TE solution during 5 min at 65 °C.The final clear DNA extract was collected by pipetting to another sterile reaction tube, during the 1 min after placing the tube at the magnetic paration support.
2. 2. 3 Nucleospin method
The NucleoSpin® Food kit ( Macherey - Nagel, Dliren, Germany) was performed according to the manufacturer instructions. Oil samples were pre - concentrated by centrifugation from a total of 180 ml of oil carefully weighed to four sterile centrifuge tubes. The oil samples were then centrifuged at 18514 g,for 30 min at 4 °C.The supernatant was discarded and the residual pellet was transferred to a t of four sterile 2 ml reaction tubes. The reaction tubes were centrifuged at 18514 g for 10 min at 4 °C , the supernatant was discarded ,and the pellet was then submitted to DNA extraction. To the pr
e - concentrated oil samples ( pellet collected) in 2 ml reaction tubes, it was added to each tube with 550 (xl of lysis Buffer CF pre - heated at 65 °C and 10 (xl of proteina K (20 mg/mL) .The mixture was incubated at 65 °C for 1 h with occasional stirring and then centrifuged at 18514 g for 10 min at 4 °C.The supernatants were transferred (400 -500 (xl) to new sterile reaction tubes, where it was added the same volume of Buffer C4 and volume of 100% ethanol. The mixtures were homogenid by inversion and the volumes of the 4 tubes were eluted through two spin columns by centrifugation at 13000 g for 1 min. The column was washed with 400 (xl of Buffer CQW, 700 (xl and 200 [j l I of C5 Buffer followed by 1 min centrifuga
Shao et al. / Oil Crop Science 1 (2016)38 -4441
tions at 13000 g and a 2 min final centrifugation. The DNA was eluted from the column by adding 50 j j l I of 0.1 X TE solution pre - heated at 70 °C , followed by 5 min incubation and centrifugation at 13000 g for 2 min.
2.3 Real - time PCR
The effeciency of DNA extraction was evaluated by real - time PCR using Brassica napus endogenous reference gene CruA as target. Primers and probes were shown in table 2 ( Savini et al.
, 2013 ) . The amplifications were carried out on a CFX96 Real - Time System (Bio - Rad Laboratories, Hercules, CA, USA) in
a final volume of 25 [jJ. The real - time mixture for TaqMan realtime PCR system contained the following reagents ： 400 nM primers, 200 nM probe, and 1 x Premix Ex Taq™(probe qPCR) (TaKaRa, Shiga, Japan) ,10 [xl template DNA. All real - time PCR reactions were carried out using the same program ： denat- uration for 30 s at 95 °C , followed by 50 cycles of 5 s at 95 °C , 60 °C annealing and extending for 1 min. Fluorescence signals were measured and collected at the end of each cycle using Manager ver. 3.1. Data were collected and procesd using CFX Manager ver. 3.1 (3.1.1517.0823) software ( Bio - rad).
pecuniaryTable 2
Primers and probes
Name
Sequence
Target Length (bp)Reference CruA-MDB510 CruA-MDB511 CruA - TM003
GTTAGAAAAAGTAAACAATTAATATAGCCGG GGAGGGTGTTTTTGGTTATCbrighton
FAM - AATATAATCGACGGATCCCCGGGAATTC - BHQ
CruA
lOlbp
(Savini et al. ,2013)
3. Results
In the ca of refined edible oils, it was difficult to obtain enough amplifiable DNA due to its low content after a complex of process (Costa et al. , 2010a; Costa et al. , 2010b). In our study, we attempted to find the most efficient method to extract enough DNA from commercial rapeed oil. However, the DNA extracted by Wizard® Magnetic DNA Purification for Food kits was still very little, and with impurities. Nanodrop 2000 spectrophotometer could not show the DNA concentration and purity accurately. In the ca of DNA extracted by the modified emulsification method, salmon sperm DNA was added as carrier so the DNA concentration will be much higher when mearsured by Nanodrop 2000 spectrophotometer. Becau of the low concentration and small fragment of extracte
d DNA, the qualitative PCR failed to show the effective bands. So we cho highly nsible, specific and reliable real -time PCR to detect the quantity of extracted DNA. For quantitative analysis, the baline threshold of relative fluorescence units was 100 for next comparison.As reported, Wizard® Magnetic DNA Purification for Food kits was successfully applied in the crude edible oil, but not for refined soybean oil ( Costa et a l., 2010a) . In our study, we failed to extract DNA from 9
rapeed oil samples using Wizard® Magnetic DNA Purification for Food kits. It was reported that Nucle- oSpin® Food kit was effective in extracting DNA from refined soybean oils (Costa et al. , 2010a). In this study, NucleoSpin® Food kits extracted DNA from fourth grade oil ( sample 1,2,3 ) and third grade oils (sample 5 ) successfully, the mean Ct values were 32.51, 34.11, 31.05 and 37.02 respectively (Figure 1 A, Table 3 ) . The emulsification method was successfully applied in the DNA extraction from palm oil (Zhang et al. , 2009 ) . In our rearch, we made some optimization through adding salmon sperm DNA in the initial step and precipitation carrier in the step of DNA precipitation. The method succeeded in extracting DNA from fourth grade oil ( sample 1,2, 3,4), third grade oil ( sample 5 and sample 7 ) and first grade oil ( sample 8 ) , and their mean Ct values were 32. 46 , 34.24, 31.21, 34.18, 36.32, 36.83 and 37.46 respectively (Figure IB, Table 3).
The results demonstrated that commercial kits Wizard® Magnetic DNA Purification for Food kits was
not effective in DNA extraction from refined rapeed oil. NucleoSpin® food kit succeeded in extracting DNA from 4 samples (3 fourth grade oil samples, 1 third grade oil sample) . The modified emulsification method extracted DNA successfully from 7 samples (4 fourth
42Shao et al. /Oil Crop Science 1 (2016)38 -44
grade oil samples，2 third grade oil samples，and 1 first grade oil sample). The results demonstrated that the modified emulsification method and the kit Nucle- oSpin® food were successful to extract DNA from refined oils. Only 50 ml volume of sample was needed in modified emulsification method, much less than the 180 ml of sample needed for the kit of NucleoSpin® food. Therefore, the modified emulsification method was superior to the kit of NucleoSpin® food in extracting efficiency.
Table 3
Amplification results of oil extracts by real - time PCR
苏黎世大学Wizard Magnatic________Nucleospin food Modified emulsification
sample
CTal CTa2CTbi CTb2Mean 土 SD CTal CT32CTbl CTb2Mean 土 SD CTal CTa2CTbi CTb2Mean 土 SD 1N N N N N32.7832.2632.3132.732.51 ±0.2732.7932.6332.2932. 1132.46 ±0.31 2N N N N N34. 9734.2133.9633.3134. 11 ±0.6934.9734.71339633.3134. 24 ±0.75 3N N N N N31.7631. 1530. 8731.0531.21 ±0.3931.7631. 1530. 8731.0531.21 ±0.39 4N N N N N N N N N N33.4335.333. 8334. 1634. 18 ±0. 8 5N N N N N37.63N35.637.0236.75 ±1.04N36.3936.24N36.32 ±0.11 6N N N N N N N N N N N N N N N 7N N N N N N N N N N36. 1141.733.9335.5936.83 ±3.38 8N N N N N N N N N N36. 8238.4737.0237.5237.46 ±0.74 9N N N N N N N N N N N N N N N
N ： No detectable amplification ( below the limit of detection of 1 DNA copy)
sandstorma, b:DNA in different tubes when running real - time PCR
1,2:DNA in different plate when running real - time PCR
SD ： Standard deviation
4. Discussion and conclusion
An efficient DNA extraction method is the basis for food authenticity and GMO detection in refined edible oil. In this study, three different methods were tested for their efficiency to extract DNA from re
fined rapeed oil. Wizard® Magnetic DNA Purification for Food kits, NucleoSpin® food kits and the emulsification method were chon for their successful application in some oil (Zhanget al. , 2009; Costa et al. , 2010b; Costa et al. , 2010a; Vietinaet al. , 2013) .According to the results from this study, Wizard Magnetic DNA Purification for Food kit was not suitable for DNA extraction from refined rapeed oil, and NucleoSpin® food kits were effective mostly for the fourth grade and some third grade oil. The modified emulsification method was more effective than the other two methods, it was also suitable for DNA extraction from some first grade rapeed oil.
The difficulty of extracting DNA from refined oil was pretreatment. From ed to edible rapeed oil, it went through multi - processing such as degumming, deacidification, decolorization, deodorization and dewaxing (Johnson et al. , 2002). Each processing can cau rious damage to DNA, so only small amount of DNA retained and the fragment was very short ( Gryson et al. , 2002 ) .There were impurities and PCR inhibitors in edible oil that were troublesome to isolate and purify DNA ( Costa et al. , 2012 ). There were two pathways that could parate DNA from oil. One was to add solution to resolve DNA, the oil was emulsified by hexane or petroleum ether, and then added PBS or CTAB solution to resolve DNA (Zhang et al. , 2009). The other was to add double distilled water, TE solution or CTAB solution to the oil, and then to extract DNA by magnetic stirring or shock. The other way
was to obtain processing residues by low temperature and high speed centrifugation and then to extract DNA from the residues, with method such as commercial kit Nu- cleoSpin® Food .
We combined the emulsification method and the National Standard of the People "s Republic of China 1485 -4 -2010, and optimized them to a new method called modified emulsification method. In the pretreatment stage, salmon sperm DNA was added as carrier to absorb and enrich the free and short - fragment DNA in rapeed oil. The DNA was precipitated by adding isopropanol and 3M sodium acetate. Dr. GenTLE® Precipitation Carrier was added to improve DNA precipitation efficiency again at - 20 °C for 2 h.
