An inducible expression system permitting the e¤cient puri¢cation of a recombinant antigen from Mycobacterium smegmatis James A.Triccas Y*,Tanya Parish ,Warwick J.Britton Y d,Brigitte Gicquel
Uniteède Geèneètique Mycobacteèrienne,Institut Pasteur,25rue du Dr.Roux,75724Paris,Cedex15,France
Department of Clinical Sciences,London School of Hygiene and Tropical Medicine,London,UK
Centenary Institute of Cancer Medicine and Cell Biology,Newtown,Australia
d Department of Medicine,University of Sydney,Sydney,Australia
Received7July1998;revid6August1998;accepted21August1998
Abstract
A novel expression vector utilising the highly inducible acetamida promoter of Mycobacterium smegmatis was constructed. High-level induction of a model antigen,the Mycobacterium leprae35kDa protein,was demonstrated in recombinant M. smegmatis grown in the prence of the acetamida inducer acetamide.The recombinant protein could be simply and efficiently purified from the bacterial s
onicate by virtue of a C-terminal6-histidine tag,demonstrating that this purification strategy can be ud for the mycobacteria.The histidine tag had no apparent effect on the protein conformation or immunogenicity,suggesting that the vector described may prove uful for the purification of native-like recombinant mycobacterial proteins from fast-growing mycobacterial hosts.z1998Federation of European Microbiological Societies. Published by Elvier Science B.V.All rights rerved.
Keywords:Expression system;Mycobacterium smegmatis;Protein puri¢cation;Acetamida
1.Introduction
Fundamental to the analysis of the biological function and immunological relevance of mycobacte-rial proteins is their production in a recombinant form that rembles that of their native counterpart. Recent studies analysing both structure[1,2]and im-munogenicity[1^3]of recombinant proteins obtained from fast-growing mycobacterial hosts,such as My-cobacterium smegmatis,have demonstrated superior-ity over the same protein puri¢ed from Escherichia coli expression systems.Although such approaches for the production of recombinant mycobacterial proteins appear advantageous,two major obstacles lie in the way of further improvement to the sys-tems.The¢rst is the inability to regulate high-level expression of foreign genes in M.smegmatis,analo-gous to syste
ms such as induction of the lac pro-moter li[4].Secondly,no simple,e¤cient and widely adaptable method for the puri¢cation of proteins from recombinant mycobacteria has been described.In this report,we attempt to resolve
0378-1097/98/$19.00ß1998Federation of European Microbiological Societies.Published by Elvier Science B.V.All rights rerved. PII:S0378-1097(98)00381-4
the two problems.Firstly,we describe the con-struction of a vector,pJAM2,that utilis the promoter of the inducible acetamida enzyme of M.smegmatis to drive high-level expression of for-eign genes in M.smegmatis.Secondly,we demon-strate the simple and e¤cient puri¢cation of our model antigen by u of a poly-histidine tag and one-step Ni P a¤nity chromatography,indicating that this versatile puri¢cation system can be adapted for u with the mycobacteria.The addition of the histidine tag did not appear to a¡ect the conforma-tion or immunogenicity of the recombinant protein, suggesting the system described may prove extremely uful for the puri¢cation of structurally and immu-nologically intact recombinant mycobacterial pro-teins from fast-growing mycobacterial hosts.女招待
2.Materials and methods
2.1.Construction of the acetamida promoter
expression vector pJAM2
The acetamida promoter region was ampli¢ed from plasmid pAMI1,which contains the M.smeg-matis NCTC9449inducible acetamida gene and upstream region[5],by u of primers HIS5 (CACGGTACCAAGCTTTCTAGCAGA)and HIS7(GTCAGTGGTGGTGGTGGTGGTGTCTA-GAAGTACTGGATCCGAAAACTACCTCG).The resulting1.5kb fragment was cloned into plasmid pJEM12[6]to give plasmid pJAM2(Fig.1).The coding region of the Mycobacterium leprae35kDa protein was ampli¢ed by primers JN8(TAGCTG-CAGGGATCCATGACGTCGGCT)and35REV2 (GTGTCTAGACTTGTACTCATG)and cloned into the Bam HI/Xba I sites of pJAM2,yielding pJAM4.
2.2.Expression and puri¢cation of recombinant
histidine-tagged protein from M.smegmatis Plasmid pJAM4was introduced into M.smegma-tis mc P155and kanamycin resistant colonies grown in M63medium(7.6U103P M(NH R)P SO R,0.5M KH P PO R,5.8U103T M FeSO R.7H P O,pH7)supple-mented with1mM MgSO R,0.5%Tween-80and2% succinate for uninduced cultures or2%succinate and 2%acetamide for induced cultures.Bacteria were grown for3days,after which cells were harvested and sonicated4times for1min.Sonicates were an-alyd for expression of the M.leprae35kDa pro-tein by SDS-PAGE and immunoblotting with the
anti-35kDa monoclonal antibody(mAb)CS38(sup-plied by Professor Patrick Brennan,Colorado State University,Colorado,USA)using the ECL detection system(Amersham Int.,Buckinghamshire,UK).For protein puri¢cation,the sonicate was applied to Ni-NTA resin(Qiagen Inc.,CA,USA)and bound pro-tein was washed concutively with5mM,20mM and40mM imidazole in sonication bu¡er(1U PBS, 5%glycerol,0.5M NaCl and5mM MgCl P).Protein was eluted with200mM imidazole in sonication bu¡er and dialyd against PBS.Non-histidine-tagged M.leprae35kDa protein derived from M. smegmatis and li35kDa6-histidine fusion protein were puri¢ed as described previously[2].
2.3.Protein capture ELISA
ELISA plates were coated with the murine anti-M. leprae35kDa mAb ML03(50W g ml3I;supplied by Professor J.Ivanyi,Hammersmith Hospital,Lon-don,UK)and mycobacterial sonicates were added at a concentration range of0.1W g ml3I to100W g ml3I.Plates were blocked with3%BSA,washed, and anti-rabbit35kDa protein polyclonal antibody (1:1000)added.Binding was visualid using alkaline phosphata conjugated anti-rabbit IgG and n-nitro-phenyl-phosphate(NPP)(1mg ml3I).Protein amount was determined by comparison with puri¢ed M.leprae35kDa protein concentration standards [2].
2.4.Asssment of protein binding by lepromatous
leprosy ra
Microtitre plates were coated with puri¢ed antigen (100pg ml3I to100W g ml3I)overnight at room temperature.Plates were washed,blocked with3% BSA,and pooled lepromatous leprosy ra(diluted 1:100)added for90min at37³C.Plates were washed,and alkaline phosphata conjugated anti-human IgG added for60min at37³C.Binding was visualid by the addition of NPP(1mg ml3I)and absorbance measured at405nm.
J.A.Triccas et al./FEMS Microbiology Letters167(1998)151^156 152
3.Results
3.1.Construction of the pJAM2vector and utilisation
怎么说话幽默for over-expression of the gene encoding the
fue
35kDa antigen of M.leprae in M.smegmatis The promoter region of the gene encoding the acetamida of M.smegmatis NCTC8159permits the inducible expression of the enzyme in the pres-ence of the substrate acetamide[4,7].In order to determine if the promoter could regulate the expres-sion of foreign genes placed under its control,the vector pJAM2was constructed(Fig.1).This plasmid
gracefully
contains approximately1.5kb upstream of the acet-amida coding region,DNA encoding the¢rst six amino acids of the acetamida gene,three restric-tion enzymes sites,and codons for6-histidine resi-dues.Thus this vector should allow for the inducible
expression of cloned foreign genes,while also permit-ting simple puri¢cation of the recombinant protein by virtue of the poly-histidine tag.In order to vali-date the system,the coding region of the M.leprae 35kDa protein was ampli¢ed and cloned into the Bam HI/Xba I sites of pJAM2to give plasmid pJAM4.This protein is a major antigen of M.leprae and reprents a promising candidate as a leprosy-speci¢c diagnostic reagent[2].This cloning step re-sulted in a fusion protein consisting of the initial six amino acids of the acetamida protein,the entire 35kDa protein,and the6-histidine residues at the C-terminus.Plasmid pJAM4was introduced into M.smegmatis mc P155,and recombinant colonies grown in minimal media containing2%succinate in the prence or abnce of2%acetamide.Soni-cates were prepared and proteins analyd by SDS-PAGE.As shown in Fig.2,left,a prominent band was visible at around37kDa in cells grown in acet-amide plus succinate(lane2),but abnt from cells grown in succinate alone(lane1).The37kDa band reacted in immunoblotting with mAb CS38,which is raid against the native M.leprae35kDa protein (Fig.2,right,lane2).
3.2.Quantitation of recombinant protein production
硕士研究生英文in M.smegmatis harbouring the pJAM4
支出英文expression construct
In order to determine an approximate measure of the level at which the35kDa protein was being produced by virtue of the acetamida promoter in M.smegmatis/pJAM4,antigen capture ELISA was employed.As shown in Fig.3,no protein was de-tected in M.smegmatis/pJAM4grown in succinate alone.In the same strain grown in the prencegoogler
of Fig.2.Inducible expression of the gene encoding the M.leprae 35kDa protein in M.smegmatis in the prence or abnce of the acetamida inducer acetamide.Left:SDS-PAGE of bacterial sonicates and purifed protein and right:immunoblotting of a corresponding gel with the anti-M.leprae35kDa mAb CS38. Lane1,M.smegmatis harbouring pJAM4grown in the abnce of acetamide;lane2,M.smegmatis harbouring pJAM4grown in the prence of acetamide;lane3,puri¢ed M.leprae35kDa
protein.
Fig.1.Genetic organisation of the pJAM2expression vector.A:
Vector map and B:nucleotide quence of the multi-cloning site
and surrounding regions.The Shine-Dalgarno quence(SD)is
shown in bold type.
shoulder是什么意思J.A.Triccas et al./FEMS Microbiology Letters167(1998)151^156153
acetamide,the35kDa protein reprented approxi-mately8.6%of the total bacterial sonicate.The level of protein produced was comparable to that in M. smegmatis harbouring plasmid pWL19[8],where ex-pression of the35kDa protein gene is driven by the non-inducible L-lactama promoter of Mycobacte-rium fortuitum,one of the strongest mycobacterial promoters characterid to date[6,9].
3.3.Puri¢cation of histidine-tagged protein from
recombinant M.smegmatiswhocare
We next determined if the high-level expression by virtue of the M.smegmatis acetamida promoter could allow e¤cient puri¢cation of the35kDa pro-tein using the6-histidine residues attached to its C-terminus.This system has been successfully ud in a number of eucaryotic and procaryotic expression
systems,and is favoured due to its simple and reli-able puri¢cation procedure,coupled with minimal e¡ects of the histidine tag on the target protein con-formation,function and immunogenicity[10]. Although the u of this system in the mycobacteria had not been previously described,it emed an ideal choice to allow the simple and rapid puri¢cation of structurally and immunologically intact recombinant mycobacterial proteins.Sonicates of M.smegmatis/ pJAM4grown in the prence of acetamide were added to Ni-NTA resin,the column washed conc-utively with varying amounts of imidazole(5mM,20 mM and40mM)and bound protein eluted with200 mM imidazole.This single-step procedure allowed a 35kDa protein of predominantly a single species to be puri¢ed(Fig.2,left,lane3).The puri¢ed product was reactive with the anti-M.leprae35kDa protein mAb CS38(Fig.2,right,lane3).The band directly beneath the35kDa protein most likely reprents a degradation product,as this band is not detected in samples analyd immediately after protein puri¢ca-tion.Therefore the strategy of Ni-NTA a¤nity chro-matography by virtue of a poly-histidine tag can be utilid for the e¡ective puri¢cation of recombinant proteins from mycobacteria.
3.4.Analysis of the e¡ect of the histidine tag on
recombinant protein conformation and
immunogenicity
Previously it was demonstrated that recombinant forms of the M.leprae35kDa protein will only react with ra from leprosy patients if the protein is pro-duced in a conformation that rembles that of the native antigen[2].This property allowed us to test the e¡ect,if any,of the histidine tag on the confor-mation of the recombinant35kDa protein.To asss this three preparations of recombinant35kDa pro-tein were ud;the histidine-tagged version puri¢ed in this study,together with a
non-histidine-tagged Fig.4.Recognition of the puri¢ed recombinant M.leprae35 kDa protein by lepromatous leprosy ra.M.smg35kDa,M. smegmatis derived35kDa protein;M.smg35kDa-HIS,M. smegmatis derived histidine-tagged35kDa li35 li derived35kDa
protein. Fig.3.Quantitation of the M.leprae protein produced in re-
combinant M.smegmatis in the prence or abnce of the acet-
amida inducer acetamide.Results are expresd as the mean
valueþS.E.M.of three experiments.Suc,succinate;Suc/Act,suc-
cinate plus acetamide.
J.A.Triccas et al./FEMS Microbiology Letters167(1998)151^156
154
version puri¢ed from M.smegmatis and li 35kDa6-histidine fusion protein.The two latter proteins were puri¢ed as described previously[2]. The binding of pooled lepromatous leprosy ra to the three forms of the35kDa protein were as-sd by ELISA.As described previously[2],the ra were not reactive with li form of the 35kDa protein(Fig.4).By contrast,the35kDa histidine fusion protein puri¢ed from M.smegma-tis/pJAM4was avidly recognid by the ra.Fur-thermore,similar reactivity was exhibited towards the same protein puri¢ed from M.smegmatis con-ta
ining no additional histidine residues,suggesting that the addition of the histidine tag had no appar-ent a¡ect on the conformation and indeed immuno-genicity of the recombinant protein.
4.Discussion
The47kDa acetamida enzyme of M.smegmatis NCTC8159permits the growth of the organism on simple amides as the sole carbon source and is highly inducible in the prence of acetamide[5,7].This property has been previously ud to asss lucifera as a reporter of gene expression in mycobacteria[11] and to develop a mycobacterial-conditional antin mutagenesis system[12].In this study,we have con-structed a vector that allows for regulated high-level expression of foreign genes in mycobacteria by virtue of the M.smegmatis acetamida promoter.Re-combinant M.leprae35kDa antigen produced in this system reprented a considerable percentage of the total M.smegmatis soluble protein,with the amount of protein produced similar to that when the same gene is placed under the control of the strong mutated L-lactama promoter of M.fortuitum(Fig.
3).Of interest to note is that we achieved high-level induction of our model antigen using the initial 1.5kb of DNA upstream of the acetamida struc-tural gene(Fig.1).Previous analysis of acetamida
regulation suggested that this initial1.5kb was not su¤cient for expression or induction of the enzyme, but elements contained within the DNA further up-stream were necessary[13].The reason for this dis-crepancy is unclear,but suggests that regulatory mechanisms associated with this enzyme are complex and require further evaluation.
Of major importance in the study of microbial antigens is the ability to produce recombinant prod-ucts in a form that cloly rembles their native state.In the ca of mycobacteria,recent studies have highlighted the superiority of recombinant pro-tein puri¢ed from mycobacterial hosts compared li derived products,as assd by structural and immunological analysis[1^3].In previous work,we demonstrated that ra from leprosy pa-tients would only recogni the M.leprae35kDa protein if the antigen was produced in a form that rembles the native protein,bad on the binding of conformational dependent mAbs and FPLC size ex-clusion analysis[2].We recon¢rm such a¢nding with the same protein produced using the acetamida promoter expression system(Fig.4).Furthermore, the addition of6-histidine residues to the C-terminus of the recombinant protein did not appear to e¡ect its conformation,as there was little di¡erence in the recognition of leprosy ra by histidine-tagged and non-histidine-tagged35kDa protein(Fig.4).The e¤cient expression of the6-histidine tag in mycobac-teria and the simple and e¡ective puri¢cation of our mod
el protein by Ni-NTA a¤nity chromatography (Fig.2)suggests that this versatile puri¢cation sys-tem,ud successfully in a number of eucaryotic and procaryotic expression systems[10]could be more widely applied to mycobacterial proteins.Further-more,the histidine puri¢cation system overcomes the problems involved with antibody a¤nity chro-matography,ud in a number of studies to purify recombinant mycobacterial proteins from mycobac-terial hosts[2,3],such as the unavailability of appro-priate antibodies or the prence of homologues cap-able of binding the antibody.Together,the results suggests an application for the pJAM2expression vector in the production of native-like recombinant mycobacterial proteins that can be exploited to cor-rectly analy protein structure,function and antige-nicity.
ophoneAcknowledgments
This work was supported by the National Health and Medical Rearch Council of Australia,NIH grant AI35207and the European Community
J.A.Triccas et al./FEMS Microbiology Letters167(1998)151^156155
