The phenylalanine ammonia-lya gene family in Salvia
miltiorrhiza :genome-wide characterization,molecular cloning and expression analysis
Xuemin Hou •Fenjuan Shao •Yimian Ma •
Shanfa Lu
Received:13December 2012/Accepted:27April 2013/Published online:4May 2013ÓSpringer Science+Business Media Dordrecht 2013
Abstract Salvia miltiorrhiza Bunge is a well-known material of traditional Chine medicine.Hydrophilic phenolic acids,such as rosmarinic acid and salvianolic acid B,are a group of pharmaceutically important compounds in S.miltiorrhiza .The biosynthesis of rosmarinic acid requires the coordination of the phenylpropanoid pathway and the tyrosine-derived pathway.Phenylalanine ammonia-lya (PAL)is the first key enzyme of the phenylpropanoid pathway.Systematic analysis of the SmPAL gene family has not been carried out.We report here the identification of three SmPALs through arching the recently obtained working draft of the S.miltiorrhiza genome and full-length cDNA cloning.Bioinformatic and phylogenetic analys showed that SmPAL1and SmPAL3clustered in a sub-clade of dicot PALs,w
hereas SmPAL2fell into the other one.Some important cis -elements were conrved in three SmPAL promoters,whereas the others were not.SmPAL1and SmPAL3were highly expresd in roots and leaves of S.miltiorrhiza ,but SmPAL2were predominately expresd in stems and flowers.It indicates that SmPAL1and SmPAL3function redundantly in rosmarinic acid biosyn-thesis.All SmPALs were induced in roots treated with PEG and MeJA,but the time and degree of respons were different,suggesting the complexity of SmPAL -associated metabolic network in S.miltiorrhiza .This is the first comprehensive study dedicated to SmPAL gene family
characterization.The results provide a basis for elucidating the role of SmPAL genes in the biosynthesis of bioactive compounds.
Keywords Phenolic acid ÁPhenylalanine ammonia-lya ÁRosmarinic acid ÁSalianolic acid B ÁSalvia miltiorrhiza ÁTraditional Chine medicine
暮光之城女主角Abbreviations 4CL 4-Coumarate:CoA liga C4H Cinnamic acid 4-hydroxyla HPPD Hydroxyphenylpyruvate dioxygena HPPR Hydroxyphenylpyruvate reducta MeJA Methyl jasmonate MW Molecular weight ORF Open reading frame PAL Phenylalanine ammonia-lya PCR Polymera chain reactions p I Isoelectric point
qRT-PCR Quantitative real-time polymera chain
reaction
RACE Rapid amplification of cDNA ends RAS Rosmarinic acid syntha TAT Tyrosine aminotransfera TCM Traditional Chine medicine
Introduction四级考试分数线
Salvia miltiorrhiza Bunge is a well-known material of various traditional Chine medicines (TCMs)that have been widely ud for treating dysmenorrhoea,amenor-rhoea,and cardiovascular dias [1].The active phar-maceutical ingredients of S.miltiorrhiza mainly include lipophilic tanshinones and hydrophilic phenolic acids.The
X.Hou
Institute of Biodiversity,College of Life Sciences,Shanxi Normal University,Linfen 041004,China
X.Hou ÁF.Shao ÁY.Ma ÁS.Lu (&)
Institute of Medicinal Plant Development,Chine Academy of Medical Sciences,Peking Union Medical College,Beijing 100193,China e-mail:sflu@implad.ac
Mol Biol Rep (2013)40:4301–4310DOI 10.1007/s11033-013-2517-3
latter is a large group of chemicals,including rosmarinic acid,salvianolic acid A,salvianolic acid B,lithospermic acid,and so forth [2].Among them,salvianolic acid B is the major component of active phenolic acids in S.mil-tiorrhiza ,while rosmarinic acid,an ester of 3,4-dihydr-oxyphenyllactic acid and caffeic acid,rves as a basis of salvianolic and lithospermic acids.The biosynthesis of rosmarinic acid requires the coordination of two indepen-dent pathways,the phenylpropanoid pathway and the tyrosine-derived pathway.The phenylpropanoid pathway is responsible for the biosynthesis of caffeic acid,whereas the tyrosine-derived pathway is devoted to 3,4-dihydroxyphe-nyllactic acid biosynthesis (Fig.1).Key enzymes involved in the two pathways include at least phenylalanine ammonia-lya (PAL),cinnamic acid 4-hydroxyla (C4H),4-coumarate:CoA liga (4CL),tyrosine amino-transfera (TAT),hydroxyphenylpyruvate reducta (HPPR),hydroxyphenylpyruvate dioxygena (HPPD),and rosmarinic acid syntha (RAS)(Fig.1).
Phenylalanine ammonia-lya (EC 4.3.1.5)is the first key enzyme in the phenylpropaniod pathway.It
catalyzes the deamination of L -phenylalanine to produce trans-cin-namic acid,which is then converted to p -coumaroyl-CoA by C4H and 4CL for the production of lignin,flavonoid,coumarin,isoflavonoid,furanocoumarin,norlignan,sal-vianolic acid B,and many other condary metabolites.PAL was first purified from Hordeum vulgare by Koukol and Connthe [3],but was shown to widely exist in plants,fungi,virus and algae afterwards.So far,there are no reports for animal PALs.However,it has been shown that PAL can play significant roles in animals and has com-mercial and medical potential.PAL is able to substantially inhibit neoplastic cell growth in vitro [4]and has the potential to treat the inherited metabolic disorder [5].Additionally,PAL may be ud in large-scale bio-con-version of trans-cinnamic acid and ammonium salts into L -phenylalanine,since the reaction catalyzed by PAL is reversible [6].
Phenylalanine ammonia-lya is encoded by a small multigene family in most plant species.There are four PAL genes in Arabidopsis thaliana [7,8],five in Populus trichocarpa [9,10],three in Scutellaria baicalensis [11],ven in Cucumis sativus [12],and three in Coffea cane-phora [13].The members of PAL gene family in a plant are usually expresd differentially in tissues and in respon to environmental stimuli and appear to be functionally distinct.For instance,among three C.canephora PALs ,CcPAL1showed high expression in roots,small green-stage beans and pericarps,followed by fl
owers,red-stage pericarps,branches,large green-stage beans,and less in other tissues analyzed.CcPAL2showed the highest expression in flowers,followed by pericarps and branches,and less in beans,roots and leaves.Whereas,CcPAL3was predominantly expresd in small green-stage beans and pericarps,large green-and red-stage pericarps,very low expression in other tissues [13].Similarly,ven C.sativus PAL genes were also differentially expresd in roots,stems,cotyledons,leaves,flowers and fruits [12].Ana-lyzing the functions uloides PALs showed that PtPAL1could be involved in the biosynthesis of condend tannins and other phenolics,whereas PtPAL2was most likely to be responsible for lignin biosynthesis [14].However,systematic analysis of the PAL gene family has not been carried out for S.miltiorrhiza .
Recently,a working draft of the S.miltiorrhiza genome has been obtained (Chen et al.unpublished data).In order to get a clear picture of the SmPAL gene family,we ar-ched the current asmbly of S.miltiorrhiza genome and then performed PCR amplification of full-length cDNAs.A total of three SmPALs were identified.Gene structures and quence characteristics of SmPALs were subquently analyzed.Expression level of SmPAL genes in various tissues of S.miltiorrhiza with or without stress treatment was examined by quantitative real-time RT-PCR.The results suggest the complexity of SmPAL -associated met-abolic network and the functional redundancy of
SmPAL1
Fig.1Propod pathways of rosmarinic acid biosynthesis in plants
and SmPAL3in rosmarinic acid biosynthesis.It provides a basis for elucidating the role of SmPAL genes in the bio-synthesis of condary metabolites,particularly the bioac-tive rosmarinic acid and salvianolic acid B.
Materials and methods
Plant materials and stress treatment
mers怎么读Salvia miltiorrhiza Bunge(line993),who genome has been quenced,was grown in afield nurry.Roots, stems,leaves andflowers were collected from2-year-old plants in August.Methyl jasmonate(MeJA)treatment was carried out as described previously[15].Drought treatment was performed by adding15%PEG-6000to6,7-V liquid media with plantlets pre-cultivated for2days.Plantlets were treated for12,24,36and48h and then roots were sampled.Plantlets treated with sterile water were ud as controls.The treatments were repeated three times.All samples were frozen immediately after collected and stored in liquid nitrogen until u.达利通
Identification of genomic quence of SmPAL gene s
The genomic quence of SmPALs were identified by BLAST analysis of four known Arabidopsis AtPALs (NM_129260,NM_115186,NM_120505,NM_111869) against the current asmbly of S.miltiorrhiza genome (Chen et al.unpublished data)using the BLASTx algo-rithm[16].An e-value cut-off of10-5was applied to the homologue recognition.Gene models were predicted as described previously[15].
Cloning of the full-length SmPAL3cDNA
Total RNA was extracted from roots of S.miltiorrhiza using the general plant total RNA extraction kit(Bioteke, Beijing,China).Poly(A)?RNA was isolated from total RNA using the Oligotex mRNA purification kit(QIAGEN, MD,CA,USA).Rapid amplification of cDNA ends (RACE)were performed using the GeneRace TM kit (Invitrogen,Carlsbad,CA,USA).PCR amplification of50 ends was carried out using the GeneRacer50primer and the nesting gene-specific primer PAL3R1(50-CCTGAACTCC TCCACCATCCTCTTCA-30).Nested PCR amplification of50ends was performed using the GeneRacer50nested primer and the nested gene-specific nested primer PAL3R2 (50-CTCTGCTTCACGCAGAACCCGTTCT-30).PCR amplification of30ends was carried out using the GeneR-acer30primer and the nesting gene-specific primer PAL3F1(50-GAGCAATGGTTTGCTCGTTGATCCT-30). Nested PCR amplification of30ends was performed using the GeneRacer30nested primer and the nested gene-spe-cific primer PAL3F2(50-GGTTTGCTCGTTGATCCTT TGTTGA-30).PCRs were performed in a kit-recommended 25l L standard amplification system using1.5l L of total first strand cDNA as a template for primary amplification and0.5l L of the primary amplification products as a template for nested amplification.The primary amplifica-tion reactions for both50and30ends were carried out under the fo
llowing conditions:predenaturation at94°C for 2min,5cycles of amplification at94°C for30s and 72°C for1min,5cycles of amplification at94°C for30s and70°C for1min,25cycles at94°C for30s,60°C for 45s and72°C for1.5min,followed by afinal extension at 72°C for15min.The nested amplification reactions for both50and30ends were carried out under the following conditions:predenaturation at94°C for2min,30cycles at 94°C for30s,60°C for45s and72°C for1.5min, followed by afinal extension at72°C for15min.PCR products were gel-purified,cloned and then quenced.
Bad on the obtained50and30cDNA quence,a pair of gene-specific primers,including the forward primer FPAL3(50-GTGTGAGCGACTTTCTCTCTCATCT-30) and the rever primer RPAL3(50-GCGGCTCTCCA TTCCACGATTCA-30),were designed for the amplifica-tion of full-length SmPAL3cDNA.PCR was carried out in a50l L volume containing1l L cDNA template, 1l L10l M FPAL3,1l L10l M RPAL3,and25l L Premix LA Taq.PCR conditions included94°C for2min, 35cycles of94°C for30s,58°C for45s and72°C for 2.5min,and72°C for15min.PCR products were gel-purified,cloned and then quenced.
Cloning of the50region of SmPAL2cDNA
50-RACE was performed using the GeneRace TM kit (Invitrogen)as described above for SmPAL3.c
DNA ud for primary amplification was transcribed from mRNA isolated from stems of S.miltiorrhiza.The nesting and nested gene-specific primers ud in the reactions were PAL2R1(50-CCTTGGAGCAATGTGTTGATTCTT-30) and PAL2R2(50-GCAGGGTGTGGTACGAATCACTAT-30),respectively.
Bioinformatic analysis and phylogenetic tree construction
The molecular weight(MW)and theoretical isoelectric point (p I)were predicted using the Compute pI/MW tool on the ExPASy rver[17](pasy/compute_pi/). Known PAL quences shown high identities with the deduced amino acid quence of SmPALs were identified by BLASTP analys of SmPALs against the databa of non-redundant protein quences in NCBI using the default
alignment bi.v/Blast. cgi).The alignment of deduced amino acid quences of SmPALs and PALs from other organisms was performed using ClustalW version1.83using the default parameters [18].Phylogenetic tree was constructed using MEGA ver-sion4.0[19].The reliability of branching was assd by the bootstrap re-sampling method using1,000bootstrap repli-cates and only nodes supported by bootstrap values[50% are shown.
Quantitative real-time PCR
Total RNA was isolated from the tissues of S.miltiorrhiza with or without stress treatment using the general plant total RNA extraction kit(Bioteke,Beijing,China)and then digested with RNa-free DNa I to remove the genomic DNA contamination.Rever transcription was carried out by SuperScript III Rever Transcripta.The reaction was achieved by incubating at65°C for5min,50°C for1h, and70°C for15min as described[20].The resulting cDNA was diluted to500l L with sterile water.Quantitative Real-time PCR was carried out in triplicate reactions using the BIO-RAD CFX system.Gene-specific primers ud were GATCTCTTCACGGAAGACCGTTGAA and GCCATTG ACGCCCATTGTGAGAGTT for SmPAL1,CAGGATC AAGGGGAGCAGATCGTA and GCACCATTCCATTC CCTGAGACA for SmPAL2,and CCCGCGATCGGGAA-CAGGATCAA and GCGGCTCTCCATTCCACGATTCA for SmPAL3.Ubiquitin gene was ud as a reference as described previously[15].The forward and rever primers for amplification of ubiquitin were AGATGGGCGGA CACTTGCTGATTA and ACTCTCCACCTCCAAAGT GATGGT,respectively.PCRs were carried out in a20l L volume containing2l L diluted cDNA,10l M forward primer,10l M rever primer and19SYBR Premix Ex TaqII using the following conditions:95°C for30s, 39cycles of95°C for5s,60°C for18s and72°C for15s. Relative abundance of transcripts was determined using the com
parative Cq method[21].For analyzing the respons of SmPALs to MeJA and PEG-6000treatments,the expression of SmPALs in roots without treatment was ud as controls and was arbitrarily t to1.Standard deviations were cal-culated from three PCR replicates.
Results
Genome-wide identification and molecular cloning
coast
of SmPALs
The decoding of the S.miltiorrhiza genome(Chen et al. unpublished data)enables us to perform a genome-wide arch of SmPALs through BLAST analysis of four known Arabidopsis AtPALs(NM_129260,NM_115186, NM_120505,NM_111869)against the current asmbly of S.miltiorrhiza genome using the BLASTx algorithm[16]. As a result,we identified a total of three genomic loci of PAL genes.It includes the known SmPAL1(accession nos. EF462460for genomic DNA and DQ408636for cDNA) [22–24],the genomic quence of SmPAL2with only partial cDNA quence available(accession no. GQ249111)and the third PAL gene,SmPAL3,which has never been reported.We then cloned the full-length SmPAL3cDNA and the50region of SmPAL2cDNA using PCR technology.Taken together,it suggests that both the genomic quence and the cDNA quenc
e of three SmPALs have been obtained and are available for com-parative analysis.
Analysis of cDNA quence of SmPALs showed that the open reading frames(ORFs)of SmPAL1,SmPAL2and SmPAL3are2,133,2,127,and2,127bp,respectively, suggesting SmPALs are highly similar in the length of ORF regions(Table1).However,substantial difference was obrved for quence identity among them.SmPAL1and SmPAL3shares85%quence identity,whereas the identity between SmPAL1and SmPAL2and between SmPAL2and SmPAL3is only75and77%,respectively, suggesting SmPAL2has less homology to SmPAL1and SmPAL3than that between SmPAL1and SmPAL3.Com-parison analysis of genomic quence and cDNA quence showed that all of three SmPAL genes contain only one intron and the exon-intron junctions satisfy the GT-AG rule for donor/acceptor sites(Fig.2).The intron is located at 386,380and380bp from ATG of SmPAL1,SmPAL2,and SmPAL3,respectively.Thefirst exon of SmPAL1includes 387bp coding quence,whereas the coding quence in thefirst exon of both SmPAL2and SmPAL3is381bp in length.The length of coding quence in the cond exon (1,750bp)is conrved among three SmPAL genes.The predicted MW and theoretical p I of SmPAL1,SmPAL2and SmPAL3proteins are77.1kDa and6.06,77.2kDa and 5.98,76.5kDa and5.96,respectively(Table1),which are consistent with previous results showing the MW of plant PALs varied from72to83kDa[25].
The deduced amino acid quence of SmPAL1, SmPAL2and SmPAL3includes711,709,and709amino acids,respectively,and shares80%identity between SmPAL1and SmPAL2,79%between SmPAL2and SmPAL3,and90%between SmPAL1and SmPAL3 (Fig.3).It suggests that SmPAL1and SmPAL3are highly homologous,whereas SmPAL2has relatively low homol-ogy with both SmPAL1and SmPAL3,which is consistent with the results from cDNA quence analysis of SmPALs. Additionally,SmPALs share over80%identity with many PALs from other plant species,such as Melissa officinalis MoPAL[26],Agastache rugosa ArPAL[27],Perilla
frutescens PfPAL,S.baicalensis SbPAL1-3[11],S.visci-dula SvPAL[28],and A.thaliana AtPAL1-4[7,8],con-firming the role of the identified SmPALs in encoding PAL in S.miltiorrhiza.In order to further characterize SmPALs, we constructed a phylogenetic tree of three SmPALs and 57PALs from other organisms.As shown in Fig.4,PALs from fungus,gymnosperms,monocots and dicots clustered to four clades and PALs from dicots might be divided into four sub-clades.SmPAL1,SmPAL2and SmPAL3were most cloly related to ArPAL,SbPAL1,and SvPAL, respectively.Like S.miltiorrhiza,A.rugosa and S.ba-icalensis and S.viscidula are members of the Lamiaceae family and are perennial herbs.SmPAL1and SmPAL3 clustered to a sub-clade with rosmarinic acid biosynthesis-related MoPAL[26],Cistanche derticola CdPAL asso-ciated with the biosynthesis of p
henhenolic compounds[29], Rehmannia glutinosa RgPAL responsive to oxidative stress [30],and various PALs with unknown functions,whereas SmPAL2clustered to the other sub-clade with veral function-unknown PALs(Fig.4).It suggests the quence diversity of SmPAL2from SmPAL1and SmPAL3. Comparative analysis of the50-flanking regions
of SmPAL genes
In order to investigate the transcriptional activity of three SmPAL gene promoters,750bp50-flanking quence of the coding region was extracted from each SmPAL gene and analyzed using the PLACE(www.jp/PLACE/)and PlantCARE databas(bioinformatics. psb.ugent.be/webtools/plantcare/html/)to identify putative cis-elements[31,32].The results showed that there were veral cis-elements conrved in the promoters of three SmPALs.It includes the box L(YCYYACCWACC),AC element(CYCACCWACC),MYB2recognition site(YA-ACKG),E-box(CANNTG),and so on(Table2).Box L is one of the three motifs(box P,YTYYMMCMAMCMMC; box A,CCGTCC;and box L)previously shown to exist in plant PAL,C4H and4CL gene promoters[33].Box L is tightly co-regulated with box A and box P and appear to be necessary but not sufficient for elicitor-or light-mediated gene activation in parsley[33].However,in S.miltiorrhiza, box A exist only in the promoter of SmPAL3and no box P was found in all SmPAL gene promoters(Table2).The abnce
of one or two of box L and box A and box P was also obrved in the promoters ichocarpa and P. tremuloides C4H genes with distinct physiological func-tions[34].It indicates that the different combination of the boxes may result in a remarkable degree of variability in gene functions.The quences of AC element and box L are overlapped and appear to play similar roles.MYB2 recognition site(YAACKG)is a cis-acting element asso-ciated with drought-induced gene expression[35].The prence of this element in all of the SmPAL gene pro-moters indicates SmPALs to be drought-induced.E-box is a cis-element recently found to be responsible for inducing gene expression in respon to MeJA treatment[36]. Examination of the promoters of SmPALs revealed that there are four E-box cis-elements in SmPAL2promoter, whereas the number of E-box cis-element in SmPAL1and SmPAL3was only one(Table2).It suggests that all three SmPALs are probably induced by MeJA treatment to var-ious degrees.
bravaIn addition to the elements conrved among three SmPALs,many elements were found only in the promoters of one or two SmPALs.For instance,AG motif(AGAT-CCAA),a cis-element sufficient to confer wounding and elicitor responsiveness[37],exists only in the promoter of SmPAL1(Table2).The results indicate that SmPALs may commonly respon to some biotic and abiotic stres-s,whereas in the other cas,the respon can be dif-ferential for individual SmPAL.T
he underlying mechanisms of SmPALs in respon to stress are compli-cated and need to be further investigated.
Tissue-specific expression of SmPAL genes
The expression levels of SmPAL1,SmPAL2and SmPAL3 in various S.miltiorrhiza tissues,including roots,stems, leaves andflowers,were analyzed using qRT-PCR.The transcripts of all three SmPAL genes could be detected in all of the tissues analyzed,but showed differential
inquiry是什么意思Table1Properties of SmPAL genes and their deduced amino acid quences
Gene ORF(bp)Protein
Length(aa)MW(kDa)p I
SmPAL12,13371177.1 6.06 SmPAL22,12770977.2 5.98
SmPAL32,12770976.5
characteristic5.96
Fig.2SmPAL gene structures.Filled boxes reprent exons with coding regions in black and50-and30-UTRs in grey.The connecting lines reprent introns.Start and stop codes are shown
expression levels (Fig.5).SmPAL1,the most abundant among three SmPALs in all of the tissues analyzed,showed the highest expression in roots,followed by leaves,stems and flowers.SmPAL2was predominately expresd in stems and flowers.Its expression levels in roots and leaves were very low.SmPAL3had the highest expression in leaves,less in roots,stems and flowers.The results suggest SmPAL1and SmPAL3can function in all of the tissues analyzed,whereas SmPAL2appears t
o play roles mainly in stems and flowers under normal conditions.Respons of SmPAL genes to PEG-6000and MeJA treatments
The prence of many environmental signal-responsive cis -elements in the promoters of SmPAL genes suggests that SmPAL genes might be involved in plant respon to stress.To test this hypothesis,we analyzed the expression level of SmPAL genes in roots of plantlets treated with PEG-6000and MeJA using qRT-PCR.The results showed that all three SmPALs were regulated by drought and MeJA treatments,although the time and degree of reaction dif-fered from one another (Fig.6).Under drought conditions,SmPAL1and SmPAL3were up-regulated to about three-folds after being treated for 24and 36h,respectively (Fig.6).The up-regulated level of SmPAL2after 36h drought treatment was the most significant,which reached to about ninefolds (Fig.6).Similar results were also obrved for SmPALs in roots of plantlets treated with MeJA for 24and 36h (Fig.6).However,down-regulation was found for all SmPALs after 12h MeJA treatment and SmPAL1was up-regulated against after 48h treatment
in
ineed
Fig.3Alignment of the deduced SmPAL amino acid quences
